Abstract
Decidualization of uterine stromal cells plays an important role in the establishment of normal pregnancy. Previous studies have demonstrated that Acyl-CoA binding protein (Acbp) is critical to cellular proliferation, differentiation, mitochondrial functions, and autophagy. The characterization and physiological function of Acbp during decidualization remain largely unknown. In the present study, we conducted the expression profile of Acbp in the endometrium of early pregnant mice. With the occurrence of decidualization, the expression of Acbp gradually increased. Similarly, Acbp expression was also strongly expressed in decidualized cells following artificial decidualization, both in vivo and in vitro. We applied the mice pseudopregnancy model to reveal that the expression of Acbp in the endometrium of early pregnant mice was not induced by embryonic signaling. Moreover, P4 significantly upregulated the expression of Acbp, whereas E2 appeared to have no regulating effect on Acbp expression in uterine stromal cells. Concurrently, we found that interfering with Acbp attenuated decidualization, and that might due to mitochondrial dysfunctions and the inhibition of fatty acid oxidation. The level of autophagy was increased after knocking down Acbp. During induced decidualization, the expression of ACBP was decreased with the treatment of rapamycin (an autophagy inducer), while increased with the addition of Chloroquine (an autophagy inhibitor). Our work suggests that Acbp plays an essential role in the proliferation and differentiation of stromal cells during decidualization through regulating mitochondrial functions, fatty acid oxidation, and autophagy.
Introduction
The successful establishment of pregnancy requires the crosstalk between the high-quality blastocyst and the receptive uterus (Wang & Dey 2006, Chaet al. 2012). In mice, the blastocyst attaches to epithelial cells and implants into stromal cells on day 5 of pregnancy (the presence of plug serves as day 1) (Wang & Dey 2006). After blastocyst implantation, the stromal cells undergo extensive proliferation and differentiation (decidualization), which is important for the maintenance of the normal pregnancy (Bany & Cross 2006, Wanget al. 2013). The stromal cells are transformed into decidual cells morphologically and functionally, which may provide energy and nutrients for embryonic development before placentation (Frolov & Ponomarev 1988, Norwitzet al. 2001, Gellersen & Brosens 2014). Various regulators are involved in the endometrial decidualization of stromal cells. However, the potential molecular mechanisms are still poorly understood.
Acyl-CoA binding protein (ACBP), also known as diazepam-binding inhibitor (DBI), is a conservative polypeptide molecule in structure and function (Tononet al. 2020). It has been detected in many eukaryotic species, such as yeast, elegans, and some other cell types (Bloksgaardet al. 2014). ACBP was originally identified in the rat brain, which could inhibit the binding of diazepam to GABA (γ-aminobutyric acid) receptor (Ferreroet al. 1986). The role of ACBP in regulating fatty acid metabolism has been verified, including regulation of β-oxidation, triglyceride, phospholipid, and cholesterol (Elholmet al. 2000). In addition, ACBP also participates in controlling cellular mitochondrial functions and autophagy (Harriset al. 2014, Masmoudi-Koukiet al. 2018, Dumanet al. 2019).
In the present study, we analyzed the expression and localization of Acbp in the uterus of early pregnancy mice. To explore the function of Acbp, we also established decidualization models of stromal cells in vivo and in vitro. We found that the expression of Acbp was closely related to decidualization. Then we interfered with the expression of Acbp with siRNA and found that Acbp may affect the decidualization of stromal cells by regulating mitochondrial function, fatty acid oxidation, and autophagy. We also revealed that the expression of Acbp was mediated by the ovary hormone progesterone. Here, we provide new insights into the function of Acbp during the decidualization of mice stromal cells.
Materials and methods
Animal samples and treatment
Animal experiments were approved by the Ethics Committee of Chongqing Medical University (no. 20200709). Mice (Kunming strain; 7–9 weeks) were purchased from the Laboratory Animal Center of Chongqing Medical University (Chongqing, China), and were able to get regular food and water in an environment controlled by temperature and light (14 h light:10 h darkness).
To obtain uterine tissues of pregnant or pseudopregnant mice, female mice were mated with fertile or vasectomized male mice described in our published study (Zhanget al. 2016). The observation of a vaginal plug was considered as day 1 of pregnancy (D1) or pseudopregnancy (PD1). Mice were sacrificed on D1 (PD1), D4 (PD4), D5 (PD5), D6 (PD6), and D8 (PD8) (n = 6/group). The uterine implantation sites (IS) of pregnant mice were visualized through intravenous injection with 0.1 mL 1% Chicago blue dye (Sigma-Aldrich Inc.), which was described in the previous report (Maet al. 2006).
The artificially induced decidualization was generated according to Kaushik’s protocol (Deb et al. 2006). Briefly, 10 µL of corn oil (Sigma-Aldrich) was infused into one side of the uterine horn on PD4 (n = 6), and the contralateral uninjected one served as the control (IDC). Part of uterine specimens was snap-frozen in liquid nitrogen and quickly stored at −80°C refrigerator for real-time-quantitative PCR (RT-qPCR), western blot, and in situ hybridization. Other uterine specimens were fixed in 4% paraformaldehyde (PFA) in PBS overnight, dehydrated using a series of gradient ethanol, and embedded in paraffin.
Immunohistochemical analysis
Five micrometer thick sections of the uterine tissues were deparaffinized and rehydrated in a serial gradient of ethanol. After retrieving the antigen, the sections were treated with 3% H2O2 for 10 min to stop the endogenous peroxidase activity and blocked with 20% normal goat serum for 30 min, following incubation with anti-ACBP rabbit polyclonal antibody (ABclonal Technology, Wuhan, China) overnight at 4°C. Subsequently, the sections were incubated with the biotinylated secondary antibody and streptavidin peroxidase (Zhongshan Biosciences, Guangzhou, China). DAB solution (Zhongshan Biosciences) was then added to the tissues and the stained sections were observed using the Olympus BX43 microscope.
In situhybridization
In situ hybridization was carried out based on prior reports (Denget al. 2014). In brief, 10-μm frozen uterine sections were mounted on 3-aminopropyltriethoxy silane (Sigma-Aldrich)-treated slides and were fixed in 4% PFA (Sigma-Aldrich). Hybridization was carried out at 55°C overnight. Sections hybridized with sense probes were used for negative controls. Following post-hybridization washing, sections were incubated in the sheep anti-digoxigenin antibody conjugated with alkaline phosphatase overnight at 4°C (1:5000; Roche Applied Science). The signal was observed by incubating with 0.4 mM 5-bromo-4-chloro-3-indolyl phosphate and 0.4 mM nitro blue tetrazolium. Levamisole (2 mM; Sigma-Aldrich) was used to inhibit endogenous alkaline phosphatase activity. All sections were counterstained with 1% methyl green (Beyotime, Shanghai, China) extracted by chloroform.
Western blot
Proteins were extracted from tissues or cells with the use of RIPA lysis buffer (Beyotime). Protein concentrations were measured with the bicinchoninic acid (BCA) Protein Assay (Beyotime). 50 μg of proteins were separated by SDS-PAGE (Beyotime) and transferred onto PVDF membranes (Sigma-Aldrich). The membranes were immunoblotted with primary antibodies. After being washed with PBST, the membranes were incubated with corresponding secondary antibodies (1:5000, Boster, Wuhan, China). The positive bands were measured by chemiluminescent reaction (Millipore). Primary antibodies used in this study are listed in Table 1. The image collection and densitometry analysis were performed using the Quantity One (Version 4.6.2; Bio-Rad), and the results were normalized with ACTB.
Primary antibodies used in this study.
| Antibody | Dilution ratio | Catalogue no. | Manufacturer |
|---|---|---|---|
| Anti-ACBP rabbit polyclonal antibody | 1:500 | ab231910 | Abcam |
| Anti-HADHA rabbit MAB | 1:10000 | ab203114 | Abcam |
| Anti-ACADM rabbit MAB | 1:10000 | ab92461 | Abcam |
| Anti-ACADVL rabbit polyclonal antibody | 1:1000 | ab155138 | Abcam |
| Anti-HOXA10 mouse MAB | 1:200 | sc-271428 | Santa Cruz Biotechnology |
| Anti- ACTB rabbit polyclonal antibody | 1:1000 | bs-0061R | Bioss, Beijing, China |
| Anti-CPT1 rabbit polyclonal antibody | 1:1000 | bs-2047R | Bioss, Beijing, China |
| Anti-PCNA mouse MAB | 1:2000 | 2586 | Cell Signaling |
| Anti-CCND3 mouse MAB | 1:2000 | 2936 | Cell Signaling |
| Anti-mTOR rabbit MAB | 1:1000 | 2983 | Cell Signaling |
| Anti-p-mTOR rabbit MAB | 1:1000 | 5536 | Cell Signaling |
| Anti-AMPK rabbit MAB | 1:1000 | 5831 | Cell Signaling |
| Anti-p-AMPK rabbit MAB | 1:1000 | 50081 | Cell Signaling |
| Anti-LC3b rabbit MAB | 1:1000 | 43566 | Cell Signaling |
| Anti-P62/SQSTM1 rabbit MAB | 1:1000 | PTM-5483 | PTM Bio, Hangzhou, China |
RT-qPCR
Total RNA extraction and RT were performed using TRIzol reagent and the cDNA synthesis kit (Takara) according to the manufacturer’s protocol. RT reaction using 1 μg RNA was carried out at 37°C for 15 min, followed by 5 s at 85°C. RT-qPCR was done using the SYBR Premix Ex TaqTM kit (Takara) with the following conditions: 95°C for 2 min, followed by 40 cycles of 95°C for 30 s and 60°C for 30 s. The sequences of the primers for RT-qPCR were listed in Table 2. The 2−ΔΔCt method was used to calculate relative expression, and ACTB was used as the internal control.
Primers for RT-qPCR.
| Gene | Sequences: 5′–3′ | Length of product (bp) | |
|---|---|---|---|
| Forward | Reverse | ||
| Acbp | AGGAGCACTACACTGACCTGA | GGTTGGTCTCTCCAAGCATCA | 167 |
| Dtprp | TGCATGGATCACTCCTGTATAC | TTTTTGAGTACCCACGTAAGGT | 141 |
| Prl3c1 | GCCACACGATATGACCGGAA | GGTTTGGCACATCTTGGTGTT | 284 |
| Hoxa10 | CCTGCCGCGAACTCCTTTT | GGCGCTTCATTACGCTTGC | 203 |
| Actb | CTACCTCAGAAGATCCTGACC | CACAGCTTCTCTTTGATGTCAC | 90 |
Isolation of primary mice endometrium stromal cells
Primary mouse endometrium stromal cells (mESCs) were isolated and cultured as in prior studies (Tan et al. 2004). Briefly, uteri were split longitudinally and cut into small pieces (2–3 mm). The pieces were digested with Hank’s Balanced Salt Solution containing 2.0 U/mL dispase II (Roche Applied Science) and 1% (w/v) trypsin (Sigma-Aldrich). 100 U/mL collagenase (Roche Applied Science) was used for the second digestion. The primary stromal cells were cultured in Dulbecco’s modified Eagle’s medium F-12 (DMEM-F12, Sigma-Aldrich) containing 10% charcoal-stripped fetal bovine serum (FBS; Biological Industries, Israel).
Hormone or chemicals impacts on mESCs
The mESCs were cultured in 2.5% FBS complete medium containing 10 nM 17-β-estradiol (estrogen, E2) (Sigma-Aldrich) and 1 µM progesterone (P4) (Sigma-Aldrich) to induce decidualization in vitro for 72 h (ID) (Zhao et al. 2013). The culture medium was changed every day.
To see which hormone impacts on mESCs proliferation or differentiation. The mESCs were treated with 10 nM E2 or 1 µM P4 or a combination of E2 and P4 at a specific time (Norwitzet al. 2001). The E2 receptor (ER) antagonist ICI 182,780 (Tocris Bioscience, Bristol, UK) (1 µM) or P4 receptor (PR) antagonist RU486 (Millipore) (1 µM) was added 2 h prior to the treatment of hormones.
For study the role of Acbp in regulating the autophagy of mESCs during decidualization, cells were treated with 2-µM rapamycin (Rapa) (MCE, Monmouth Junction, NJ, USA) or 25-µM chloroquine (CQ) (Sigma-Aldrich) for 48 h to induce or suppress autophagy.
Immunofluorescent staining of mESCs
The mESCs were seeded onto coverslips and cultured in 24-well culture plates. Cells were fixed in cold methanol when reached 70–80% confluence. After being permeabilized with 0.1% Triton, cells were blocked with 1% BSA for 1 h. The cells were incubated with the anti-vimentin rabbit polyclonal antibody (1:100, Cell Signaling Technology) overnight at 4°C. After being washed with PBS, the cells were incubated with an Alexa Fluor 594-conjugated secondary antibody (1:100, Zhongshan Biosciences, Beijing, China) at 37°C for 1 h. Nuclei were stained with DAPI (Sigma-Aldrich) for 5 min, and images were taken with the Olympus BX43 microscope.
siRNA transfection
Acbp knockdown was done by using siRNA designed to specifically targeting Acbp mRNA (si-acbp) (Gene Pharma, Shanghai, China) (Table 3). Seventy-two hours prior to cell harvest, si-acbp or scrambled control siRNA was transfected into the mESCs at 500 nM concentration using TransIntroTM Transfection reagent (TransGen Biotech, China) according to the manufacturer’s instruction. Twenty-four hours after transfection, mESCs were treated with or without induction of decidualization. To ID, mESCs were cultured in complete medium containing DMEM/F12 supplemented with C-FBS, 10 nM 17-β-estradiol (estrogen, E2) (Sigma-Aldrich), and 1-µM progesterone (P4) (Sigma-Aldrich). The medium was changed every day.
Sequences of the siRNA.
| Gene | Sequences: 5′–3′ | |
|---|---|---|
| Sense | Antisense | |
| si-Acbp | CCUUGUUGGUCUGAAGUUUTT | AAACUUCAGACCAACAAGGTT |
| Scrambled Control (NC) | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
The proliferation detection
The proliferation of mESCs was detected using the EdU Cell Proliferation Assay Kits (Beyotime) and Cell Counting Kit 8 (CCK8) (Abcam) assay. For the EdU assay, the mESCs were exposed to EdU reagent for 2 h, and fixed with 4% formaldehyde. After addition of 0.5% Triton X-100, the mESCs were incubated with click additive solution for 30 min. Nuclei were stained with Hoechst 33342 (Sigma-Aldrich), and visualized as blue. More than three random fields per well were captured to calculate the number of proliferating cells (Zhanget al. 2016).
For the CCK8 assay, the cells were seeded into 96-well culture plates; 100 μL culture medium containing 10% CCK8 reagent was added into the cells per well. Then the cells were incubated at 37°C for 1 h in a humidified atmosphere of 5% CO2. mESCs were treated with the different concentrations of etomoxir for 24 h before detection. Measurement of the absorbance was done at 450 nm with a microplate reader (Thermo Fisher Scientific).
Reactive oxygen species assay and mitochondrial membrane potential detection
The mESCs were seeded in 24-well (3 × 105) or 96-well (2 × 103) culture plates for reactive oxygen species (ROS) detection by 2,7-dichlorodihydrofluorescein diacetate (Beyotime) and mitochondrial membrane potential detection by 5,5′,6,6′-tetrachloro-1,1′,3,3′-tetraethylbenzimi-dazolyl carbocyanine iodide (JC-1) staining (Beyotime) according to the standard protocol. The stained cells were observed using the Olympus BX43 microscope and 96-well plates were analyzed with a microplate reader (Thermo Fisher Scientific). The excitation wavelength of JC-1 monomer (Green) is 488 nm and the emission wavelength is 525 nm; the excitation wavelength of JC-1 polymer (J-aggregates) (Red) is 561 nm and the maximum emission wavelength is 590 nm (Liaoet al. 2016).
Detection of ATP content
Intracellular ATP amount was measured using the ATP content detection kit according to the instructions of the manufacturer (Solarbio, Beijing, China). In brief, 1 × 106 cells were lysed with 100 µL lysis buffer and centrifuged at 13,800 g for 5 min at 4°C. Then, 20 µL of each supernatant was mixed with 100 µL of ATP detection working solution, and assayed by a microplate reader (Thermo Fisher Scientific). Results were normalized to the cell protein content.
Flow cytometry detection
Fatty acid oxidation was determined with the use of a fatty acid oxidation flow cytometry kit (Abcam) according to the instructions of the manufacturer (Pascualet al. 2017, Tabeet al. 2017). Briefly, the treated mESCs were harvested, fixed, and permeabilized in suspension. The cells were incubated with the anti-HADHA rabbit MAB (1:10,000, Abcam) or the anti-acyl-CoA dehydrogenase medium chain (ACADM) mouse MAB (1:10,000, Abcam) or the anti-acyl-CoA dehydrogenase very long chain (ACADVL) rabbit polyclonal antibody (1:1000, Abcam), respectively. Flow cytometry was used to detect cells after fluorescent secondary antibodies incubation.
Statistical analysis
Each experiment was repeated at least three times. GraphPad Prism 6.0 was utilized for the statistical analyses. Differences between the groups were assessed using Student’s t-test or one-way ANOVA. *P < 0.05, **P < 0.01, and ***P < 0.001 were considered statistically significant.
Results
Expression profile of Acbp in the endometrium during mice early pregnancy
We detected the spatiotemporal expression and localization of Acbp in the endometrium during the early pregnancy of D1, D4, D5, D6, and D8. The immunohistochemical results (Fig. 1A) showed that ACBP was expressed in the luminal and glandular epithelial cells on D1. ACBP expression was slightly expressed in the stroma cells on D4 with the raised progesterone secretion. The dynamic expression of ACBP from epithelium cells to stromal cells implied that ovary hormones estrogen and progesterone might play a role in regulating endometrial ACBP expression. On day 5 of pregnancy, with embryo implantation, ACBP was expressed in stromal cells surrounding the implantation site (IS) that initially formed the primary decidual zone (PDZ). Further, the positive signal of ACBP staining was detected in the secondary decidual zone (SDZ) on both D6 and D8. Similarly, the Acbp mRNA level was also measured in the uteri during early pregnancy in mice. As shown in Fig. 1B, in situ hybridization depicts a higher level of Acbp mRNA in the outcroppings of the LE on Day 1, which decreases on Day 4. And the expression of Acbp mRNA was detected in the PDZ on D5 and the SDZ on D6 and D8. The staining pattern of in situ hybridization was consistent well with the immunohistochemical staining results.
Acbp expression profile in the endometrium during mouse early pregnancy (n = 6/group). (A) Immunohistochemical analysis of the expression and localization of ACBP protein in the uteri during mouse early pregnancy of day 1(D1), D4, D5, D6, and D8. (B) In situ hybridization detection of Acbp mRNA expression and localization in mouse uteri of early pregnancy of D1, D4, D5, D6, and D8. (C) Western blot measurement of ACBP protein in mouse early pregnancy endometrium and (D) the quantification of western blot results. (E) RT-qPCR evaluation of Acbp mRNA in mouse early pregnancy endometrium. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 µm or 200 µm or 500 µm. Each experiment was repeated at least three times. D, day of pregnancy; ge, glandular epithelium; IS, implantation site; IIS, inter-implantation site; le, luminal epithelium; NC, negative control; ns, no significance; PDZ, primary decidual zone; SDZ, secondary decidual zone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression profile in the endometrium during mouse early pregnancy (n = 6/group). (A) Immunohistochemical analysis of the expression and localization of ACBP protein in the uteri during mouse early pregnancy of day 1(D1), D4, D5, D6, and D8. (B) In situ hybridization detection of Acbp mRNA expression and localization in mouse uteri of early pregnancy of D1, D4, D5, D6, and D8. (C) Western blot measurement of ACBP protein in mouse early pregnancy endometrium and (D) the quantification of western blot results. (E) RT-qPCR evaluation of Acbp mRNA in mouse early pregnancy endometrium. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 µm or 200 µm or 500 µm. Each experiment was repeated at least three times. D, day of pregnancy; ge, glandular epithelium; IS, implantation site; IIS, inter-implantation site; le, luminal epithelium; NC, negative control; ns, no significance; PDZ, primary decidual zone; SDZ, secondary decidual zone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression profile in the endometrium during mouse early pregnancy (n = 6/group). (A) Immunohistochemical analysis of the expression and localization of ACBP protein in the uteri during mouse early pregnancy of day 1(D1), D4, D5, D6, and D8. (B) In situ hybridization detection of Acbp mRNA expression and localization in mouse uteri of early pregnancy of D1, D4, D5, D6, and D8. (C) Western blot measurement of ACBP protein in mouse early pregnancy endometrium and (D) the quantification of western blot results. (E) RT-qPCR evaluation of Acbp mRNA in mouse early pregnancy endometrium. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 µm or 200 µm or 500 µm. Each experiment was repeated at least three times. D, day of pregnancy; ge, glandular epithelium; IS, implantation site; IIS, inter-implantation site; le, luminal epithelium; NC, negative control; ns, no significance; PDZ, primary decidual zone; SDZ, secondary decidual zone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Western blot results (Fig. 1C and D) showed that ACBP protein expression was lower on D1 than on D4, D5, D6, and D8 during the early pregnancy in mice. The expression of ACBP reached the maximum on D8. However, there was no significant difference in ACBP protein expression between the IS and the IIS on D5 and D6 (Fig. 1D). The mRNA levels of Acbp measured by RT-qPCR (Fig. 1E) agreed well with the protein level of ACBP. On D5 and D6, Acbp mRNA level was significantly higher in the IS than in the IIS. Acbp was spatiotemporally expressed in the endometrium, implying that Acbp may be involved in the decidualization of the stromal cells during the early pregnancy in mice.
Expression of Acbp in the endometrium during mice early pseudopregnancy
To reveal whether the expression of Acbp was induced by embryonic signaling, we applied the mice pseudopregnancy model. According to the analysis of immunohistochemistry, ACBP was expressed in the epithelium cells and weakly expressed in stromal cells (Fig. 2A). Western blot (Fig. 2B and C) and RT-qPCR (Fig. 2D) results indicated that the expression of Acbp on PD1 was lower than that on other pseudopregnant days. These results suggest that the expression of Acbp in the endometrium during mice early pregnancy was not induced by embryonic signaling.
Acbp expression profile in the pseudopregnant mouse endometrial (n = 6/group). (A) Immunohistochemical detection of the localization and expression of ACBP in the uteri during mouse pseudopregnancy day 1 (PD1), PD4, PD5, PD6, and PD8. (B) Western blot evaluation of ACBP protein expression in mouse pseudopregnant endometrium and (C) the quantification of western blot results. (D) RT-qPCR detection of Acbp mRNA level in mouse pseudopregnant endometrium. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 200 µm. Each experiment was repeated at least three times. ge, glandular epithelium; le, luminal epithelium; ns, no significance; PD, day of pseudopregnancy.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression profile in the pseudopregnant mouse endometrial (n = 6/group). (A) Immunohistochemical detection of the localization and expression of ACBP in the uteri during mouse pseudopregnancy day 1 (PD1), PD4, PD5, PD6, and PD8. (B) Western blot evaluation of ACBP protein expression in mouse pseudopregnant endometrium and (C) the quantification of western blot results. (D) RT-qPCR detection of Acbp mRNA level in mouse pseudopregnant endometrium. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 200 µm. Each experiment was repeated at least three times. ge, glandular epithelium; le, luminal epithelium; ns, no significance; PD, day of pseudopregnancy.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression profile in the pseudopregnant mouse endometrial (n = 6/group). (A) Immunohistochemical detection of the localization and expression of ACBP in the uteri during mouse pseudopregnancy day 1 (PD1), PD4, PD5, PD6, and PD8. (B) Western blot evaluation of ACBP protein expression in mouse pseudopregnant endometrium and (C) the quantification of western blot results. (D) RT-qPCR detection of Acbp mRNA level in mouse pseudopregnant endometrium. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 200 µm. Each experiment was repeated at least three times. ge, glandular epithelium; le, luminal epithelium; ns, no significance; PD, day of pseudopregnancy.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression in mice endometrium under artificially induced decidualization in vivo
To further explore Acbp expression during decidualization, the artificially induced decidualization model of mice in vivo was established. The morphology of the uterus (Fig. 3A), the increased uterine weight (Fig. 3B), and the expression of decidual marker gene decidual/trophoblast prolactin-related protein (Dtprp) (Fig. 3C) were used to evaluate the successful establishment of the model. In situ hybridization assay (Fig. 3E) showed that Acbp mRNA expression in ID was extremely stronger than that in uninjected control (IDC). The immunohistochemical results (Fig. 3D) showed that ACBP protein was expressed in most cells in the ID group compared with the IDC group. Besides, Acbpexpression in uteri under induced decidualization was higher than that in the untreated control group (Fig. 3F, G and H). These results demonstrate differential expression of Acbp during decidualization.
Acbp expression in mouse uteri under artificially induced decidualization in vivo. (A) Morphological analysis, (B) weight measurement and (C) RT-qPCR assay of decidualization marker Dtprp mRNA level in uteri under artificially induced decidualization in vivo. On the day 5 of pseudo-pregnancy (PD5), one side of the uterine horn was injected with 10 μL corn oil (ID) and the other side served as the control (IDC). (D) Immunohistochemical staining of ACBP in the untreated control (up, IDC) and the induced decidualization (down, ID). The right column is the high magnification of the left columns. (E) In situ hybridization analysis of Acbpexpression in uteri of IDC and ID. The right column is the high magnification of the left columns. (F) Western blot measurement of ACBP protein expression under artificially induced decidualization in vivo and (G) the quantification of western blot results. (H) RT-qPCR detection of Acbp mRNA level under artificially induced decidualization. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 50 μm or 500 μm. Each experiment was repeated at least three times. dc, decidual cells; ge, glandular epithelium; le: luminal epithelium.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression in mouse uteri under artificially induced decidualization in vivo. (A) Morphological analysis, (B) weight measurement and (C) RT-qPCR assay of decidualization marker Dtprp mRNA level in uteri under artificially induced decidualization in vivo. On the day 5 of pseudo-pregnancy (PD5), one side of the uterine horn was injected with 10 μL corn oil (ID) and the other side served as the control (IDC). (D) Immunohistochemical staining of ACBP in the untreated control (up, IDC) and the induced decidualization (down, ID). The right column is the high magnification of the left columns. (E) In situ hybridization analysis of Acbpexpression in uteri of IDC and ID. The right column is the high magnification of the left columns. (F) Western blot measurement of ACBP protein expression under artificially induced decidualization in vivo and (G) the quantification of western blot results. (H) RT-qPCR detection of Acbp mRNA level under artificially induced decidualization. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 50 μm or 500 μm. Each experiment was repeated at least three times. dc, decidual cells; ge, glandular epithelium; le: luminal epithelium.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp expression in mouse uteri under artificially induced decidualization in vivo. (A) Morphological analysis, (B) weight measurement and (C) RT-qPCR assay of decidualization marker Dtprp mRNA level in uteri under artificially induced decidualization in vivo. On the day 5 of pseudo-pregnancy (PD5), one side of the uterine horn was injected with 10 μL corn oil (ID) and the other side served as the control (IDC). (D) Immunohistochemical staining of ACBP in the untreated control (up, IDC) and the induced decidualization (down, ID). The right column is the high magnification of the left columns. (E) In situ hybridization analysis of Acbpexpression in uteri of IDC and ID. The right column is the high magnification of the left columns. (F) Western blot measurement of ACBP protein expression under artificially induced decidualization in vivo and (G) the quantification of western blot results. (H) RT-qPCR detection of Acbp mRNA level under artificially induced decidualization. ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 50 μm or 500 μm. Each experiment was repeated at least three times. dc, decidual cells; ge, glandular epithelium; le: luminal epithelium.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp plays an important role in mESCs induced decidualization in vitro
To further investigate the functions of Acbp during decidualization, mESCs were isolated and identified (Supplementary Fig. 1, see section on supplementary materials given at the end of this article). To induce decidualization of mESCs in vitro, the combined treatment of E2 and P4 for 72 h was applied. After induction of E2 and P4, RT-qPCR results showed that the expression of decidualization marker Dtprp was upregulated (Fig. 4A), and WB results showed that the expression of decidualization marker homeobox A10 (HOXA10) was also increased (Fig. 4C and D). These results indicated that the decidualization of stromal cells in vitro was successful. As expected, Acbp was significantly increased after induction of E2 and P4 compared with the vehicle control (CON) (Fig. 4B, C and D).
The effect of Acbp knockdown on proliferation and differentiation in mESCs under induced decidualization in vitro. (A) Dtprp mRNA expression was assessed in mESCs during in vitro decidualization by RT-qPCR. (B) Acbp expression was assessed via RT-qPCR. (C) ACBP and HOXA10 protein levels were assessed in mESCs during in vitro decidualization by western blot and (D) the quantification of western blot results. (E) RT-qPCR detection of Acbp, Dtprp, Prl3c1,and Hoxa10 mRNA levels in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (F) Protein levels of ACBP, CCND3, PCNA, and HOXA10 in mESCs after knocking down Acbp under in vitro induced decidualization (ID) and (G) the quantification of western blot results. (H) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by CCK8 measurement. (I) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by Edu detection. (J) The statistical analysis of EdU results (three or four random fields were counted). *P < 0.05, **P < 0.01 and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 μm. Each experiment was repeated at least three times. Acbp, acyl-coa binding protein; CCND3, cyclin D3; Dtprp, prolactin family 8, subfamily a, member 2; Hoxa10, homeobox a10; PCNA, proliferating cell nuclear antigen protein; Prl3c1, prolactin family 3, subfamily c, member 1.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The effect of Acbp knockdown on proliferation and differentiation in mESCs under induced decidualization in vitro. (A) Dtprp mRNA expression was assessed in mESCs during in vitro decidualization by RT-qPCR. (B) Acbp expression was assessed via RT-qPCR. (C) ACBP and HOXA10 protein levels were assessed in mESCs during in vitro decidualization by western blot and (D) the quantification of western blot results. (E) RT-qPCR detection of Acbp, Dtprp, Prl3c1,and Hoxa10 mRNA levels in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (F) Protein levels of ACBP, CCND3, PCNA, and HOXA10 in mESCs after knocking down Acbp under in vitro induced decidualization (ID) and (G) the quantification of western blot results. (H) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by CCK8 measurement. (I) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by Edu detection. (J) The statistical analysis of EdU results (three or four random fields were counted). *P < 0.05, **P < 0.01 and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 μm. Each experiment was repeated at least three times. Acbp, acyl-coa binding protein; CCND3, cyclin D3; Dtprp, prolactin family 8, subfamily a, member 2; Hoxa10, homeobox a10; PCNA, proliferating cell nuclear antigen protein; Prl3c1, prolactin family 3, subfamily c, member 1.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The effect of Acbp knockdown on proliferation and differentiation in mESCs under induced decidualization in vitro. (A) Dtprp mRNA expression was assessed in mESCs during in vitro decidualization by RT-qPCR. (B) Acbp expression was assessed via RT-qPCR. (C) ACBP and HOXA10 protein levels were assessed in mESCs during in vitro decidualization by western blot and (D) the quantification of western blot results. (E) RT-qPCR detection of Acbp, Dtprp, Prl3c1,and Hoxa10 mRNA levels in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (F) Protein levels of ACBP, CCND3, PCNA, and HOXA10 in mESCs after knocking down Acbp under in vitro induced decidualization (ID) and (G) the quantification of western blot results. (H) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by CCK8 measurement. (I) Effects of interfering with Acbp in mESCs during in vitro induced decidualization on proliferation by Edu detection. (J) The statistical analysis of EdU results (three or four random fields were counted). *P < 0.05, **P < 0.01 and ***P < 0.001. β-actin (ACTB) was used as an internal control. Scale bar, 100 μm. Each experiment was repeated at least three times. Acbp, acyl-coa binding protein; CCND3, cyclin D3; Dtprp, prolactin family 8, subfamily a, member 2; Hoxa10, homeobox a10; PCNA, proliferating cell nuclear antigen protein; Prl3c1, prolactin family 3, subfamily c, member 1.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The cell proliferation and differentiation are vital for decidualization (Afsharet al. 2012). We then detected the expression of decidualization and proliferation makers in Acbp knocking down mESCs (the knockdown efficiency of Acbp was shown in Supplementary Fig. 2). We found that knocking down Acbp significantly decreased the expressions of decidualization markers, Hoxa10, Dtprp, and prolactin family 3, subfamily c, member 1 (Prl3c1), compared with control cells (Fig. 4E). As shown in Fig. 4F and G, the expressions of proliferation markers, proliferating cell nuclear antigen (PCNA), and cyclin D3 (CCND3), were lower in the si-acbp-ID group than that in the scrm-ID group. Moreover, CCK8 (Fig. 4H) and EdU assay (Fig. 4I and J) results were in accordance with western blot detection of proliferation markers.
The expression of Acbp is regulated by progesterone
The mESCs were treated with E2 or P4 or both E2 and P4 to see which hormone is vital for Acbp expression. As exhibited in Fig. 5, the expression of ACBP protein in mESCs was induced in a time-dependent manner by P4 (Fig. 5A and B), while the expression of ACBP did not change significantly with the increase of treatment time when treated by E2 only. The upregulation of ACBP expression was not as obvious when treated with E2+P4 as P4 treatment only. These results suggest that E2 may attenuate upregulation of ACBP in the E2+P4 group. Moreover, the stimulation of ACBP expression by P4 was inhibited by the addition of RU486 (an antagonist of progesterone receptor) in advance (Fig. 5C and D). However, there was no effect of the ICI 182,780 (an antagonist of estrogen receptor) on ACBP expression (Fig. 5E and F). These results imply that P4 regulates ACBP expression via the PR-dependent manner in mESCs.
The expression of Acbp is regulated by progesterone. (A) ACBP protein levels in mESCs with the treatment of E2 and/or P4 and (B) the quantification of western blot results. (C) ACBP protein levels in mESCs treated with RU486 (the PR antagonist) and (D) the quantification of western blot results. (E) ACBP protein levels in mESCs treated with ICI 182,780 (the ER antagonist) and (F) the quantification of western blot results. E2, 17-β-estradiol (estrogen); Add ICI 182,780 (1 μM) or RU486 (1 μM) 2 h before hormone treatment. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ns, no significance; P4, progesterone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The expression of Acbp is regulated by progesterone. (A) ACBP protein levels in mESCs with the treatment of E2 and/or P4 and (B) the quantification of western blot results. (C) ACBP protein levels in mESCs treated with RU486 (the PR antagonist) and (D) the quantification of western blot results. (E) ACBP protein levels in mESCs treated with ICI 182,780 (the ER antagonist) and (F) the quantification of western blot results. E2, 17-β-estradiol (estrogen); Add ICI 182,780 (1 μM) or RU486 (1 μM) 2 h before hormone treatment. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ns, no significance; P4, progesterone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The expression of Acbp is regulated by progesterone. (A) ACBP protein levels in mESCs with the treatment of E2 and/or P4 and (B) the quantification of western blot results. (C) ACBP protein levels in mESCs treated with RU486 (the PR antagonist) and (D) the quantification of western blot results. (E) ACBP protein levels in mESCs treated with ICI 182,780 (the ER antagonist) and (F) the quantification of western blot results. E2, 17-β-estradiol (estrogen); Add ICI 182,780 (1 μM) or RU486 (1 μM) 2 h before hormone treatment. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ns, no significance; P4, progesterone.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp regulates decidualization by modulating mitochondrial functions and fatty acid oxidation
Previous studies have demonstrated that Acbp regulates mitochondrial functions in various cell types (Masmoudi-Koukiet al. 2018, Dumanet al. 2019). Therefore, we surmised that Acbp may participate in regulating mitochondrial functions during decidualization. As demonstrated in Fig. 6, the production of ROS was increased in the si-acbp-ID group compared with the scrm-ID group (Fig. 6A and B). The JC-1 assay results showed that mitochondrial membrane potential was decreased in the si-acbp-ID group compared with the scrm-ID group (Fig. 6C and D). In addition, intracellular ATP content was inhibited when Acbp was knocked down (Fig. 6E).
The effect of Acbp knockdown on the mitochondrial functions in mESCs during induced decidualization in vitro. (A) Fluorescence staining images of intracellular ROS in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (B) The statistical analysis of ROS fluorescence intensity. (C) Fluorescence staining images of MMP in mESCs after knocking down Acbp under in vitro induced decidualization (ID). JC-1 monomer was showed as green and polymer was showed as red. (D) The statistical analysis of mitochondrial membrane potentials fluorescence intensity. (E) The measurement of ATP content. *P < 0.05 and **P < 0.01. Scale bar, 200 μm. Each experiment was repeated at least three times. mmp, mitochondria membrane potentials; ROS, reactive oxygen species.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The effect of Acbp knockdown on the mitochondrial functions in mESCs during induced decidualization in vitro. (A) Fluorescence staining images of intracellular ROS in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (B) The statistical analysis of ROS fluorescence intensity. (C) Fluorescence staining images of MMP in mESCs after knocking down Acbp under in vitro induced decidualization (ID). JC-1 monomer was showed as green and polymer was showed as red. (D) The statistical analysis of mitochondrial membrane potentials fluorescence intensity. (E) The measurement of ATP content. *P < 0.05 and **P < 0.01. Scale bar, 200 μm. Each experiment was repeated at least three times. mmp, mitochondria membrane potentials; ROS, reactive oxygen species.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The effect of Acbp knockdown on the mitochondrial functions in mESCs during induced decidualization in vitro. (A) Fluorescence staining images of intracellular ROS in mESCs after knocking down Acbp under in vitro induced decidualization (ID). (B) The statistical analysis of ROS fluorescence intensity. (C) Fluorescence staining images of MMP in mESCs after knocking down Acbp under in vitro induced decidualization (ID). JC-1 monomer was showed as green and polymer was showed as red. (D) The statistical analysis of mitochondrial membrane potentials fluorescence intensity. (E) The measurement of ATP content. *P < 0.05 and **P < 0.01. Scale bar, 200 μm. Each experiment was repeated at least three times. mmp, mitochondria membrane potentials; ROS, reactive oxygen species.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
Acbp has been demonstrated in transporting acyl-CoA (the active form of fatty acid) to the mitochondria for further fatty acid oxidation (Harriset al. 2014, Dumanet al. 2019). Hence, we detected the expressions of key enzymes of fatty acid oxidation when Acbp was inhibited. The results showed that knocking down Acbp inhibited hydroxyacyl-coa dehydrogenase trifunctional multienzyme complex subunit α (HADHA) and ACADM in mESCs during induced decidualization (Fig. 7). However, there was no difference in ACADVL expression between the two groups (Fig. 7A, B, C and D). Western blot results were in accordance with the flow cytometry results (Fig. 7E and F). These results indicate that ACBP participated in decidualization by regulating fatty acid oxidation.
The influence of Acbp knockdown on fatty acid oxidation in mESCs during decidualization. (A-D) Effects of Acbp knockdown on fatty acid oxidation during mESCs decidualization by flow cytometry. (E) Effects of Acbp knockdown or etomoxir on fatty acid oxidation during mESCs decidualization by western blot and (F) the quantification of western blot results. (G) RT-qPCR detection of Dtprp, Prl3cl,and Hoxa10 mRNA levels in mESCs during decidualization with or without etomoxir (25 μM). The ID mESCs were treated with 25 μM of etomoxir for 24 h before collection. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ACADM, acyl-CoA dehydrogenase medium chain; ACADVL, acyl-CoA dehydrogenase very long chain; CPT1, carnitine palmitoyltransferase 1; HADHA, hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit α.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The influence of Acbp knockdown on fatty acid oxidation in mESCs during decidualization. (A-D) Effects of Acbp knockdown on fatty acid oxidation during mESCs decidualization by flow cytometry. (E) Effects of Acbp knockdown or etomoxir on fatty acid oxidation during mESCs decidualization by western blot and (F) the quantification of western blot results. (G) RT-qPCR detection of Dtprp, Prl3cl,and Hoxa10 mRNA levels in mESCs during decidualization with or without etomoxir (25 μM). The ID mESCs were treated with 25 μM of etomoxir for 24 h before collection. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ACADM, acyl-CoA dehydrogenase medium chain; ACADVL, acyl-CoA dehydrogenase very long chain; CPT1, carnitine palmitoyltransferase 1; HADHA, hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit α.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The influence of Acbp knockdown on fatty acid oxidation in mESCs during decidualization. (A-D) Effects of Acbp knockdown on fatty acid oxidation during mESCs decidualization by flow cytometry. (E) Effects of Acbp knockdown or etomoxir on fatty acid oxidation during mESCs decidualization by western blot and (F) the quantification of western blot results. (G) RT-qPCR detection of Dtprp, Prl3cl,and Hoxa10 mRNA levels in mESCs during decidualization with or without etomoxir (25 μM). The ID mESCs were treated with 25 μM of etomoxir for 24 h before collection. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times. ACADM, acyl-CoA dehydrogenase medium chain; ACADVL, acyl-CoA dehydrogenase very long chain; CPT1, carnitine palmitoyltransferase 1; HADHA, hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex subunit α.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
To confirm the regulation of Acbp in fatty acid oxidation during decidualization, an inhibitor of carnitine palmitoyltransferase 1 (CPT1), etomoxir (ET), was applied for further detection since CPT1 is a rate-limiting enzyme for fatty acid oxidation (Teinet al. 1989). Firstly, according to western blot and CCK8 results, 25 μM ET was selected (Supplementary Fig. 3). As shown in Fig. 7E and F, ACBP regulated CPT1 in mESCs during induced decidualization in vitro. Moreover, the expression of mouse decidualization markers was significantly repressed under the treatment of etomoxir (Fig. 7G).
Acbp participates in autophagy regulation during decidualization
Since Acbp also regulates autophagy (Pedroet al. 2019), we characterized the effects of Acbp on autophagy during mESCs decidualization. Our results showed that the expression of microtubule-associated protein 1 light chain 3 beta (MAP1LC3/LC3b), after knocking down Acbp,was significantly upregulated with the decreasing of sequestosome 1 (SQSTM1/P62), which indicated activation of autophagy (Fig. 8B). We also evaluated the roles of AMP-activated protein kinase (AMPK) and mammalian target of rapamycin (mTOR) which were the regulators of autophagy. The level of p-mTOR decreased and the level of p-AMPK increased in the si-acbp-ID group (Fig. 8A and B), which suggests that the level of autophagy is elevated. These findings indicate that changes in Acbp expression affect the level of autophagy during decidualization.
The impacts of ACBP on autophagy during decidualization. (A) Representative images from western blot assays against LC3b-I and -II, ACBP, P62, p-mTOR, mTOR, p-AMPK, AMPK, and ACTB. (B) The ratios of LC3b-II to LC3b-I, p-mTOR to total mTOR, and p-AMPK to total AMPK were quantified based on western blot images from at least three independent experiments. (C–D) Each group underwent induced decidualization and rapamycin (Rapa) was added to the culture if necessary. (C) Representative images from immunoblot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (D) The quantification of three western blot results. (E–F) Each group underwent induced decidualization and Chloroquine (CQ) was added to the culture if necessary. (E) Representative images from western blot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (F) The quantification of three western blot results. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The impacts of ACBP on autophagy during decidualization. (A) Representative images from western blot assays against LC3b-I and -II, ACBP, P62, p-mTOR, mTOR, p-AMPK, AMPK, and ACTB. (B) The ratios of LC3b-II to LC3b-I, p-mTOR to total mTOR, and p-AMPK to total AMPK were quantified based on western blot images from at least three independent experiments. (C–D) Each group underwent induced decidualization and rapamycin (Rapa) was added to the culture if necessary. (C) Representative images from immunoblot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (D) The quantification of three western blot results. (E–F) Each group underwent induced decidualization and Chloroquine (CQ) was added to the culture if necessary. (E) Representative images from western blot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (F) The quantification of three western blot results. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
The impacts of ACBP on autophagy during decidualization. (A) Representative images from western blot assays against LC3b-I and -II, ACBP, P62, p-mTOR, mTOR, p-AMPK, AMPK, and ACTB. (B) The ratios of LC3b-II to LC3b-I, p-mTOR to total mTOR, and p-AMPK to total AMPK were quantified based on western blot images from at least three independent experiments. (C–D) Each group underwent induced decidualization and rapamycin (Rapa) was added to the culture if necessary. (C) Representative images from immunoblot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (D) The quantification of three western blot results. (E–F) Each group underwent induced decidualization and Chloroquine (CQ) was added to the culture if necessary. (E) Representative images from western blot assays against LC3b-I and -II, ACBP, HOXA10, P62, and ACTB. (F) The quantification of three western blot results. *P < 0.05, **P < 0.01, and ***P < 0.001. β-actin (ACTB) was used as an internal control. Each experiment was repeated at least three times.
Citation: Reproduction 163, 5; 10.1530/REP-21-0430
To further clarify the effects of Acbp expression on autophagy during decidualization, an autophagy inducer, Rapa, and an autophagy inhibitor, chloroquine (CQ), were included in the culture medium of different group of cells. Unsurprisingly, compared with the group without Rapa, the formation of LC3b-II increased and P62 expression decreased (Fig. 8C and D) with the treatment of Rapa. ACBP expression was lower in the group with the addition of Rapa than in the si-acbp-ID group (Fig. 8C and D). Meanwhile, LC3b-II formation and P62 expression were upregulated and ACBP expression increased (Fig. 8E and F) after the treatment of CQ. These findings indicate that the change in autophagy level did affect ACBP expression in mESCs.
We also explored whether the regulation of autophagy level could rescue the damage of decidualization caused by Acbp knockdown. The expression of the decidual marker, HOXA10, was further downregulated with Rapa treatment (Fig. 8C and D). However, with the treatment of CQ, the expression of HOXA10 was upregulated, which means that decidualization was rescued to a certain extent (Fig. 8E and F).
Discussion
Infertility affects about 15% of couples of reproductive years, mainly due to implantation failure or abnormal decidualization (Moriet al. 2011, Srogaet al. 2012). During early pregnancy, the decidualization process of endometrial stromal cells proliferation and differentiation supports embryo development and early pregnancy (Ramathalet al. 2010). In mice, the decidualization occurs after the implantation of blastocyst on day 5 of pregnancy (Salamonsenet al. 2001). While in human beings, the decidualization first begins in the late-secretory phase surrounding the spiral arteries of the uterus (Navotet al. 1991). According to previous studies, Acbp plays an important role in the differentiation and proliferation of various cell types (Mandrupet al. 1998, Harriset al. 2014, Dumanet al. 2019). We found that Acbp was strongly expressed in decidual zones during mice early pregnancy, which indicates a potential role of Acbp in the decidualization of stromal cells (Fig. 1).
During the functional transformation from stromal cells to decidualized cells (Gellersen & Brosens 2014), cells secret prolactin, such as Dtprp and Prl3c1, two well-known markers of decidualization (Clementiet al. 2013, Liet al. 2016). Another marker of decidualization of stromal cells is Hoxa10 (homeobox transcription factor) (Wang & Dey 2006). The Hoxa10-/-mice are infertile, owing to the inhibition of stromal cells proliferation (Bensonet al. 1996). Here, we found that interfering of Acbp repressed the decidualization markers’ expression (Fig. 4E and F), indicating its function in regulating decidualization.
The proliferation of stromal cells plays an important role in implantation and decidualization (Wanget al. 2013). On day 5 of pregnancy, stromal cells undergo proliferation and form the primary decidual zone (PDZ) around the implantation site. On the following day, stromal cells begin to proliferate, then the secondary decidual zone (SDZ) appears. Our previous studies have proved that two markers of proliferation, cyclin D3 and PCNA, were remarkably upregulated in mESCs during induced decidualization (Zhanget al. 2016, Fenget al. 2017). Besides, Acbpis able to regulate proliferation in non-small cell lung cancer and glioblastoma (Harriset al. 2014, Yunet al. 2017, Dumanet al. 2019). In our study, we found that CCND3 and PCNA expressions were downregulated after interfering with Acbpexpression (Fig. 4F and G). We can conclude that Acbp regulated proliferation during decidualization.
Mitochondria, as the place of oxidative phosphorylation and fatty acid oxidation, produces ATP for various cellular processes (Chan 2006). The respiratory chain transfers electrons to the series of electron acceptors, and electron leakage can lead to the production of ROS (McCrannet al. 2009a, b). The asymmetric distribution of electrons between two sides of the mitochondrial inner membrane forms mitochondrial membrane potential (MMP), which is essential for ATP production and oxidative phosphorylation (Koppenol & Margoliash 1982). It has been reported that mitochondrial activity plays an important role during stromal cells decidualization polyploidy (Almadaet al. 2016). Abnormal mitochondrial activity and decreasing ATP production result in poor implantation rates in older women (Bartmannet al. 2004). When Acbp is knocked down, the production of ATP content reduces in glioblastoma tumorigenesis (Dumanet al. 2019). ODN, the biologically active fragments of ACBP, prevents the dropping of MMP and inhibits the accumulation of ROS in neurons (Masmoudi-Koukiet al. 2018). Our results are in accordance with those published studies. We found that downregulation of Acbp expression elevated the production of mitochondrial ROS, and decreased the production of mitochondrial membrane potential and ATP (Fig. 6). These results suggest that mitochondrial dysfunction is related to the impairment of decidualization caused by the downregulation of Acbp expression.
Fatty acid oxidation is demonstrated that plays an important role in embryo development and decidualization (Sturmeyet al. 2009, Tsaiet al. 2014). Decidualization of stromal cells treated with an inhibitor of fatty acid oxidation is attenuated (Tsaiet al. 2014). CPT1, the rate-limiting enzyme of fatty acid oxidation, is regulated by Acbp(Harriset al. 2014). We found that interference with Acbp or inhibition of CPT1 attenuated the expression of key enzymes of fatty acid oxidation (HADHA and ACADM) in mESCs during induced decidualization (Fig. 7). However, knockdown of Acbp or inhibition of CPT1 had no effect on ACADVL expression. We speculated that this may be due to tissue specificity or other pathways regulating ACADVL during decidualization. These results suggest that fatty acid oxidation is also related to the impairment of decidualization.
The ovarian steroid hormones estrogen (E2) collaborated with progesterone (P4) to regulate the proliferation and differentiation of epithelial and stromal cells, which is necessary for early pregnancy events (Huet-Hudsonet al. 1989). Estrogen promotes the proliferation of epithelial cells on day 1 and day 2, and progesterone facilitates stromal cells proliferation on day 3 and day 4. After implantation, decidualization of stromal cells is governed by progesterone (Norwitzet al. 2001). Interestingly, we demonstrated that ACBP was regulated by progesterone in stromal cells rather than estrogen, which implied that ACBP plays a significant role in decidualization under the control of progesterone (Fig. 5).
Endometrial cells have a dynamic autophagy process in the periodic growth and shedding off during the menstrual cycle (Yanget al. 2019). The inhibition of autophagy results in abnormal decidualization (Mestre Citrinovitz et al. 2019, Suet al. 2020). We found that under ID condition, inhibition of Acbp upregulated the level of autophagy (Fig. 8A and B). The possible reason is that autophagy needs to be maintained at a specific level during decidualization. And excessive upregulation or downregulation of autophagy may affect decidualization. To further explore the effects of interference with Acbp and autophagy regulation on decidualization, we added rapamycin (an autophagy inducer) or chloroquine (an autophagy inhibitor) to the mESCs culture medium. We found that under the condition of interference with Acbp, upregulation of autophagy inhibited decidualization, while downregulation of autophagy could rescue decidualization to a certain extent (Fig. 8C, D, E, and F).
In conclusion, our present study has determined the dynamic localization and expression of Acbp in the mouse early pregnancy endometrium for the first time. Furthermore, Acbp plays an essential role in decidualization by regulating mitochondrial functions, fatty acid oxidation, and autophagy. However, further studies are needed to reveal the details of the mechanisms involved.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-21-0430.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Key Research and Development Program of China (Grant No. 2018YFC1004400), National Natural Science Foundation of China (Grant No. 82104923), Science and Technology Commission of Yuzhong District of Chongqing (Grant No. 20190134).
Author contribution statement
All authors listed have made a substantial, direct and intellectual contribution to the work, and approved it for publication.
References
Afshar Y, Jeong JW, Roqueiro D, Demayo F, Lydon J, Radtke F, Radnor R, Miele L & Fazleabas A 2012 Notch1 mediates uterine stromal differentiation and is critical for complete decidualization in the mouse. FASEB Journal 26 282–294. (https://doi.org/10.1096/fj.11-184663)
Almada M, Amaral C, Diniz-Da-Costa M, Correia-Da-Silva G, Teixeira NA & Fonseca BM 2016 The endocannabinoid anandamide impairs in vitro decidualization of human cells. Reproduction 152 351–361. (https://doi.org/10.1530/REP-16-0364)
Bany BM & Cross JC 2006 Post-implantation mouse conceptuses produce paracrine signals that regulate the uterine endometrium undergoing decidualization. Developmental Biology 294 445–456. (https://doi.org/10.1016/j.ydbio.2006.03.006)
Bartmann AK, Romao GS, Ramos Eda Eda S & Ferriani RA 2004 Why do older women have poor implantation rates? A possible role of the mitochondria. Journal of Assisted Reproduction and Genetics 21 79–83. (https://doi.org/10.1023/b:jarg.0000027018.02425.15)
Benson GV, Lim H, Paria BC, Satokata I, Dey SK & Maas RL 1996 Mechanisms of reduced fertility in Hoxa-10 mutant mouse: uterine homeosis and loss of maternal Hoxa-10 expression. Development 122 2687–2696. (https://doi.org/10.1242/dev.122.9.2687)
Bloksgaard M, Neess D, Faergeman NJ & Mandrup S 2014 Acyl-CoA binding protein and epidermal barrier function. Biochimica et Biophysica Acta 1841 369–376. (https://doi.org/10.1016/j.bbalip.2013.09.013)
Cha J, Sun X & Dey SK 2012 Mechanisms of implantation: strategies for successful pregnancy. Nature Medicine 18 1754–1767. (https://doi.org/10.1038/nm.3012)
Chan DC 2006 Mitochondria: dynamic organelles in disease, aging, and development. Cell 125 1241–1252. (https://doi.org/10.1016/j.cell.2006.06.010)
Clementi C, Tripurani SK, Large MJ, Edson MA, Creighton CJ, Hawkins SM, Kovanci E, Kaartinen V, Lydon JP & Pangas SA et al.2013 Activin-like kinase 2 functions in peri-implantation uterine signaling in mouse and humans. PLoS Genetics 9 e1003863. (https://doi.org/10.1371/journal.pgen.1003863)
Deb K, Reese J & Paria BC 2006 Methodologies to study implantation in mice. Methods in Molecular Medicine 121 9–34. (https://doi.org/10.1385/1-59259-983-4:007)
Deng WB, Liang XH, Liu JL & Yang ZM 2014 Regulation and function of deiodinases during decidualization in female mouse. Endocrinology 155 2704–2717. (https://doi.org/10.1210/en.2014-1015)
Duman C, Yaqubi K, Hoffmann A, Acikgoz AA, Korshunov A, Bendszus M, Herold-Mende C, Liu HK & Alfonso J 2019 Acyl-CoA-binding protein drives glioblastoma tumorigenesis by sustaining fatty acid oxidation. Cell Metabolism 30 274 .e5–289.e5. (https://doi.org/10.1016/j.cmet.2019.04.004)
Elholm M, Garras A, Neve S, Tornehave D, Lund TB, Skorve J, Flatmark T, Kristiansen K & Berge RK 2000 Long-chain acyl-CoA esters and acyl-CoA binding protein are present in the nucleus of rat liver cells. Journal of Lipid Research 41 538–545. (https://doi.org/10.1016/S0022-2275(2032401-9)
Feng Q, Hu ZY, Liu XQ, Zhang X, Lan X, Geng YQ, Chen XM, He JL, Wang YX & Ding YB 2017 Stomatin-like protein 2 is involved in endometrial stromal cell proliferation and differentiation during decidualization in mouse and humans. Reproductive Biomedicine Online 34 191–202. (https://doi.org/10.1016/j.rbmo.2016.11.009)
Ferrero P, Santi MR, Conti-Tronconi B, Costa E & Guidotti A 1986 Study of an octadecaneuropeptide derived from diazepam binding inhibitor (DBI): biological activity and presence in rat brain. PNAS 83 827–831. (https://doi.org/10.1073/pnas.83.3.827)
Frolov AA & Ponomarev VN 1988 Accuracy of the spatial localization of the sources of brain bioelectrical activity in a model homogeneous unrestricted environment. Zhurnal Vysshei Nervnoi Deiatelnosti Imeni I P Pavlova 38 897–904.
Gellersen B & Brosens JJ 2014 Cyclic decidualization of the human endometrium in reproductive health and failure. Endocrine Reviews 35 851–905. (https://doi.org/10.1210/er.2014-1045)
Harris FT, Rahman SM, Hassanein M, Qian J, Hoeksema MD, Chen H, Eisenberg R, Chaurand P, Caprioli RM & Shiota M et al.2014 Acyl-coenzyme A-binding protein regulates beta-oxidation required for growth and survival of non-small cell lung cancer. Cancer Prevention Research 7 748–757. (https://doi.org/10.1158/1940-6207.CAPR-14-0057)
Huet-Hudson YM, Andrews GK & Dey SK 1989 Cell type-specific localization of c-myc protein in the mouse uterus: modulation by steroid hormones and analysis of the periimplantation period. Endocrinology 125 1683–1690. (https://doi.org/10.1210/endo-125-3-1683)
Koppenol WH & Margoliash E 1982 The asymmetric distribution of charges on the surface of horse cytochrome c. Functional implications. Journal of Biological Chemistry 257 4426–4437. (https://doi.org/10.1016/S0021-9258(1834740-9)
Li DD, Zhao SY, Yang ZQ, Duan CC, Guo CH, Zhang HL, Geng S, Yue ZP & Guo B 2016 Hmgn5 functions downstream of Hoxa10 to regulate uterine decidualization in mouse. Cell Cycle 15 2792–2805. (https://doi.org/10.1080/15384101.2016.1220459)
Liao W, Zhang R, Dong C, Yu Z & Ren J 2016 Novel walnut peptide-selenium hybrids with enhanced anticancer synergism: facile synthesis and mechanistic investigation of anticancer activity. International Journal of Nanomedicine 11 1305–1321. (https://doi.org/10.2147/IJN.S92257)
Ma XH, Hu SJ, Ni H, Zhao YC, Tian Z, Liu JL, Ren G, Liang XH, Yu H & Wan P et al.2006 Serial analysis of gene expression in mouse uterus at the implantation site. Journal of Biological Chemistry 281 9351–9360. (https://doi.org/10.1074/jbc.M511512200)
Masmoudi-Kouki O, Hamdi Y, Ghouili I, Bahdoudi S, Kaddour H, Leprince J, Castel H, Vaudry H, Amri M & Vaudry D et al.2018 Neuroprotection with the endozepine octadecaneuropeptide, ODN. Current Pharmaceutical Design 24 3918–3925. (https://doi.org/10.2174/1381612824666181112111746)
McCrann DJ, Eliades A, Makitalo M, Matsuno K & Ravid K 2009a Differential expression of NADPH oxidases in megakaryocytes and their role in polyploidy. Blood 114 1243–1249. (https://doi.org/10.1182/blood-2008-12-195883)
McCrann DJ, Yang D, Chen H, Carroll S & Ravid K 2009b Upregulation of Nox4 in the aging vasculature and its association with smooth muscle cell polyploidy. Cell Cycle 8 902–908. (https://doi.org/10.4161/cc.8.6.7900)
Mestre Citrinovitz AC, Strowitzki T & Germeyer A 2019 Decreased autophagy impairs decidualization of human endometrial stromal cells: a role for ATG proteins in endometrial physiology. International Journal of Molecular Sciences 20 3066. (https://doi.org/10.3390/ijms20123066)
Mori M, Kitazume M, Ose R, Kurokawa J, Koga K, Osuga Y, Arai S & Miyazaki T 2011 Death effector domain-containing protein (DEDD) is required for uterine decidualization during early pregnancy in mouse. Journal of Clinical Investigation 121 318–327. (https://doi.org/10.1172/JCI44723)
Navot D, Scott RT, Droesch K, Veeck LL, Liu HC & Rosenwaks Z 1991 The window of embryo transfer and the efficiency of human conception in vitro. Fertility and Sterility 55 114–118. (https://doi.org/10.1016/s0015-0282(1654069-2)
Norwitz ER, Schust DJ & Fisher SJ 2001 Implantation and the survival of early pregnancy. New England Journal of Medicine 345 1400–1408. (https://doi.org/10.1056/NEJMra000763)
Pascual G, Avgustinova A, Mejetta S, Martin M, Castellanos A, Attolini CS, Berenguer A, Prats N, Toll A & Hueto JA et al.2017 Targeting metastasis-initiating cells through the fatty acid receptor CD36. Nature 541 41–45. (https://doi.org/10.1038/nature20791)
Pedro JMB-S, Sica V, Martins I, Anagnostopoulos G, Maiuri C & Kroemer G 2019 Cell-autonomous, paracrine and neuroendocrine feedback regulation of autophagy by DBI/ACBP (diazepam binding inhibitor, acyl-CoA binding protein): the obesity factor. Autophagy 15 2036–2038. (https://doi.org/10.1080/15548627.2019.1662585)
Ramathal CY, Bagchi IC, Taylor RN & Bagchi MK 2010 Endometrial decidualization: of mouse and men. Seminars in Reproductive Medicine 28 17–26. (https://doi.org/10.1055/s-0029-1242989)
Salamonsen LA, Nie G, Dimitriadis E, Robb L & Findlay JK 2001 Genes involved in implantation. Reproduction, Fertility, and Development 13 41–49. (https://doi.org/10.1071/rd00046)
Sroga JM, Ma X & Das SK 2012 Developmental regulation of decidual cell polyploidy at the site of implantation. Frontiers in Bioscience 4 1475–1486. (https://doi.org/10.2741/s347)
Sturmey RG, Reis A, Leese HJ & Mcevoy TG 2009 Role of fatty acids in energy provision during oocyte maturation and early embryo development. Reproduction in Domestic Animals 44 (Supplement 3) 50–58. (https://doi.org/10.1111/j.1439-0531.2009.01402.x)
Su Y, Zhang JJ, He JL, Liu XQ, Chen XM, Ding YB, Tong C, Peng C, Geng YQ & Wang YX et al.2020 Endometrial autophagy is essential for embryo implantation during early pregnancy. Journal of Molecular Medicine 98 555–567. (https://doi.org/10.1007/s00109-019-01849-y)
Tabe Y, Yamamoto S, Saitoh K, Sekihara K, Monma N, Ikeo K, Mogushi K, Shikami M, Ruvolo V & Ishizawa J et al.2017 Bone marrow adipocytes facilitate fatty acid oxidation activating AMPK and a transcriptional network supporting survival of acute monocytic leukemia cells. Cancer Research 77 1453–1464. (https://doi.org/10.1158/0008-5472.CAN-16-1645)
Tan Y, Li M, Cox S, Davis MK, Tawfik O, Paria BC & Das SK 2004 HB-EGF directs stromal cell polyploidy and decidualization via cyclin D3 during implantation. Developmental Biology 265 181–195. (https://doi.org/10.1016/j.ydbio.2003.09.019)
Tein I, Demaugre F, Bonnefont JP & Saudubray JM 1989 Normal muscle CPT1 and CPT2 activities in hepatic presentation patients with CPT1 deficiency in fibroblasts. Tissue specific isoforms of CPT1? Journal of the Neurological Sciences 92 229–245. (https://doi.org/10.1016/0022-510x(8990139-1)
Tonon MC, Vaudry H, Chuquet J, Guillebaud F, Fan J, Masmoudi-Kouki O, Vaudry D, Lanfray D, Morin F & Prevot V et al.2020 Endozepines and their receptors: structure, functions and pathophysiological significance. Pharmacology and Therapeutics 208 107386. (https://doi.org/10.1016/j.pharmthera.2019.06.008)
Tsai JH, Chi MM, Schulte MB & Moley KH 2014 The fatty acid beta-oxidation pathway is important for decidualization of endometrial stromal cells in both humans and mouse. Biology of Reproduction 90 34. (https://doi.org/10.1095/biolreprod.113.113217)
Wang H & Dey SK 2006 Roadmap to embryo implantation: clues from mouse models. Nature Reviews: Genetics 7 185–199. (https://doi.org/10.1038/nrg1808)
Wang Q, Lu J, Zhang S, Wang S, Wang W, Wang B, Wang F, Chen Q, Duan E & Leitges M et al.2013 Wnt6 is essential for stromal cell proliferation during decidualization in mouse. Biology of Reproduction 88 5. (https://doi.org/10.1095/biolreprod.112.104687)
Yang S, Wang H, Li D & Li M 2019 Role of endometrial autophagy in physiological and pathophysiological processes. Journal of Cancer 10 3459–3471. (https://doi.org/10.7150/jca.31742)
Yun SH, Shin SW & Park JI 2017 Expression of fatty acid synthase is regulated by PGC1alpha and contributes to increased cell proliferation. Oncology Reports 38 3497–3506. (https://doi.org/10.3892/or.2017.6044)
Zhang X, Fu LJ, Liu XQ, Hu ZY, Jiang Y, Gao RF, Feng Q, Lan X, Geng YQ & Chen XM et al.2016 nm23 regulates decidualization through the PI3K-Akt-mTOR signaling pathways in mouse and humans. Human Reproduction 31 2339–2351. (https://doi.org/10.1093/humrep/dew191)
Zhao Y, Park S, Bagchi MK, Taylor RN & Katzenellenbogen BS 2013 The coregulator, repressor of estrogen receptor activity (REA), is a crucial regulator of the timing and magnitude of uterine decidualization. Endocrinology 154 1349–1360. (https://doi.org/10.1210/en.2012-2026)
