Abstract
In brief
Normal gene expression during early embryonic development and in the placenta is crucial for a successful pregnancy. Nicotine can disrupt normal gene expression during development, leading to abnormal embryonic and placental development.
Abstract
Nicotine is a common indoor air pollutant that is present in cigarette fumes. Due to its lipophilic nature, nicotine can rapidly transport through membrane barriers and spread throughout the body, which can lead to the development of diseases. However, the impact of nicotine exposure during early embryonic development on subsequent development remains elusive. In this study, we found that nicotine significantly elevated reactive oxygen species, DNA damage and cell apoptosis levels with the decrease of blastocyst formation during early embryonic development. More importantly, nicotine exposure during early embryonic development increased placental weight and disrupted placental structure. In molecular level, we also observed that nicotine exposure could specifically cause the hypermethylation of Phlda2 promoter (a maternally expressed imprinted gene associated with placental development) and reduce the mRNA expression of Phlda2. By RNA sequencing analysis, we demonstrated that nicotine exposure affected the gene expression and excessive activation of the Notch signaling pathway thereby affecting placental development. Blocking the Notch signaling pathway by DAPT treatment could recover abnormal placental weight and structure induced by nicotine exposure. Taken together, this study indicates that nicotine causes the declining quality of early embryos and leads to placental abnormalities related to over-activation of the Notch signaling pathway.
Introduction
The adverse impact of smoking on reproduction has been brought to the attention of various researchers; therefore, the associated health risks have been widely publicized (Holbrook 2016). According to the report of the World Health Organization, more than 8 million people are killed by tobacco all over the world in 1 year. Among the 4000 harmful ingredients in tobacco smoke, nicotine is the major component that leads to many adverse outcomes of smoking. Nicotine is rapidly distributed throughout the body, with the highest affinity found particularly in the brain (Mahajan et al. 2021), lungs (Gibbs et al. 2016), heart (Nordenstam 2021), kidneys (Nordenstam 2021) and placental tissues (Suter & Aagaard 2020). Especially, nicotine can traverse membrane barriers and accumulate in placental tissue readily (Dahlstrom et al. 1990, Henderson & Lester 2015). Previous reports indicated that fetal and neonatal exposure to nicotine led to a wide range of a long-term health problems in the offspring, including childhood obesity, metabolic disorders and postnatal reproductive defects (Bruin et al. 2010, Behl et al. 2013).
Reactive oxygen species (ROS) are involved in many cellular biological processes, including mitochondria depolarization, DNA damage response and cell apoptosis (Yang et al. 1998, Das et al. 2009). Nicotine exposure leads to excessive levels of ROS and disrupts oxidative/antioxidative balance of the embryo and fetus both in vivo and in vitro (Zhao & Reece 2005, Bruin et al. 2008). In the post-implantation stage, within 24 h of nicotine treatment, a variety of malformations is triggered in E8.5 embryos and increased levels of cell apoptosis is seen by increasing ROS levels (Zhao & Reece 2005). Continuous nicotine treatment of dams during pregnancy and lactation increases ROS levels and induces beta-cell apoptosis in the offspring (Bruin et al. 2008).
The placenta plays a crucial role in connecting the mother and fetus and is responsible for a range of physiological processes, such as nutrient transport, endocrine function and immune regulation (Hoo et al. 2020). Moreover, it also acts as a protective barrier shielding the fetus from external pathogens and toxins. Many studies focused on the effects of environmental toxins on the placenta (Warner et al. 2021). Holloway et al. found that nicotine exposure decreased interstitial trophoblast invasion and increased placental hypoxia and vascularization of the labyrinth placental. In rats, nicotine exposure increases the levels of endoplasmic reticulum (ER) stress, leading to placental hypoxia and amino acid starvation (Wong et al. 2015). However, the effects of nicotine on the placenta and the underlying regulatory mechanisms are not extensively studied.
The Notch signaling pathway is highly conserved among the eukaryotes and critical for preimplantation embryo development (Borggrefe & Oswald 2009, Falo-Sanjuan & Bray 2022). In mammals, the Notch signaling pathway is composed of four receptors (Notch 1–4) and five ligands (Delta-like (Dll) 1, 3 and 4; Jagged1 and 2) (Guruharsha et al. 2012, Bray 2016, Alfred & Vaccari 2018). Ligands released by neighboring cells are bound by cellular transmembrane receptors, resulting in the cleavage of intracellular structural domain (NICD) of the receptor by ADAM proteases outside the cell. It has been reported that the Notch signaling pathway is associated with several key biological events of placental formation, including specification of trophoblast cell types, branching of the chorion, morphogenesis of the fetal vasculature, and formation of the maternal circulation (Gasperowicz & Otto 2008). Lu et al. found the loss of Rbpj, a core transcriptional mediator of the Notch signaling pathway, may be associated with the disorder during choroiallantonic differentiation and placental development (Lu et al. 2019). In many experiments, DAPT is commonly used as an inhibitor of the Notch signaling pathway, including in early embryonic (Batista et al. 2021) and placental cells (Perlman et al. 2021). In this study, we investigated the effects of nicotine on mouse early embryonic development and found that it increased the levels of ROS, DNA damage and cell apoptosis level in early embryos. Additionally, through embryo transplantation, we observed nicotine exposure causes disturbance to placental structure, and this disturbance was partially caused by over-activation of the Notch pathway. These findings suggest that exposure to nicotine during early embryonic development can lead to detrimental effects on both the embryo and placenta, highlighting the importance of avoiding nicotine exposure during pregnancy.
Materials and methods
Animals
Eight-week-old ICR mice were fed a regular diet and housed in SPF room with 45–60% average humidity, with temperature-controlled 25°C and standard 12-h light cycles. All procedures were conducted according to the rules stipulated by the Animal Care and Use Committee of Huazhong Agricultural University (HZAUMO-2019-070).
Embryo collection and culture in vitro
ICR female mice were super-ovulated by intraperitoneal injection of 10 IU pregnant mare’s serum gonadotrophin (PMSG, Ningbo Hormone Product, China) and 48 h later followed by human chorionic gonadotrophin (hCG, Ningbo Hormone Product, China). Female mice with vaginal plugs were sacrificed by cervical dislocation and embryos were collected from the oviducts after 18 h. Embryos were cultured in G1-Plus medium (Vitrolife) at 37.5°C, 5% CO2 with saturated humidity ultimately. For nicotine (Sigma-Aldrich) treatment, nicotine was prepared into 5 M and diluted by G1-Plus media to 1 mM or 1.5 mM. According to the manufacturer’s instructions, DAPT (D5942, Sigma) was diluted in DMSO and added into G1-Plus medium with a concentration of 50 μM. Isolation of the inner cell mass (ICM) and trophectoderm (TE) from blastocysts is that the zona pellucida of the blastocysts was removed using 0.5% pronase E (07433-Sigma), followed by culture in Ca2+-free CZB for 30–45 min. The junctions between the TE cells and ICM cells were then separated by gentle pipetting using a glass needle.
Immunofluorescence staining
Embryos were fixed in 4% paraformaldehyde (PFA)–PBS buffer for 4°C overnight and permeabilized in 0.1% Triton X-100 for 1 h at room temperature. After that, embryos were blocked with 3% BSA-supplemented PBS for 1 h and incubated with anti-H3K4me3 (1:2000, Abcam), anti-H3K27me3 (1:2000, Abcam), anti-H3K27ac (1:1000, Abcam), anti-γ-H2AX (1:2000, Abcam) antibody for 1 h at room temperature, then incubated with the secondary antibody at room temperature for 1 h. Between each step, embryos were washed three times with wash buffer (PBS containing 0.1% Tween 20 and 0.01% Triton X-100). Then embryos were counterstained with 4′,6-diamidino-2-phenylindoledihydrochloride. For Annexin-V staining, embryos were stained for 30 min in the darkness with a binding buffer containing Annexin-V-FITC (Beyotime Institute of Biotechnology, Shanghai, China). For ROS level analysis, embryos were incubated with the oxidation-sensitive fluorescent probe for 30 min at 37°C in DPBS that contained 10 mM dichlorofluorescein diacetate (DHE-DA, Beyotime Institute of Biotechnology). For TUNEL-staining analysis, embryos were labeled with an in situ cell death detection kit with Fluorescein (Beyotime Institute of Biotechnology, C1090) according to the manufacturer's instructions. Finally, embryos were mounted on glass slides and observed under a fluorescence microscope (Olympus). The fluorescence intensity was measured using ImageJ software (NIH). In brief, the images were converted into an 8-bit format and the region of interest (ROI) was set to match the size of the embryos using the auto threshold adjustment with the default settings. The mean gray value within the ROI was calculated as the average fluorescence intensity per unit area using the Set Measurements window.
RNA sequencing
Fifteen morulae were collected and generated using the Smart-seq2 protocol for RNA sequencing (RNA-seq). Briefly, after removing the zona pellucida from embryos with an acidic solution, embryos were transferred to lysis buffer and then reverse transcribed and cDNA amplified using Vazyme TruePrep DNA library preparation (Vazyme, TD503-01 and TD202/207). The amplified products were purified by magnetic beads and fragments were screened before being sequenced and analyzed using the Illumina HiSeq Xten system.
RNA-seq data processing
Reads of RNA-seq were mapped to the mm10 genome (GRCm38) by STAR using default parameters. Gene annotation files were downloaded from the UCSC Genome Browser, and the gene expression levels were quantified by the feature Count program. Afterward, differentially expressed genes were calculated using the DESeq2 software in R. Fold change ≥1 and P values ≤0.05 were considered differentially expressed genes.
RNA isolation and real-time RT-PCR
Gene expression was detected using real-time RT-PCR and △Ct method. For the placenta, total RNA was extracted from homogenized whole placentas using TRIzol reagent (Invitrogen). Chloroform was then added to the solution and then centrifuged at 13,000 g. The supernatant was transferred to a fresh tube with an equal volume of isopropanol and centrifuged again at 13,000 g. Total RNA was then collected from the pellet and dissolved in DEPC-treated water. For embryos, total RNA was isolated from 30 morulae using RNA prep Pure Micro kit (Tiangen, Garze, China, DP420), reversed to cDNA using HiScript II Q Select RT SuperMix for qPCR (Vazyme, R233) following the manufacturer’s instructions, and then stored at −20°C until use. Quantitative real-time PCR was performed using ChamQ Universal SYBR qPCR Master Mix (Vazyme, Q711). Data from control embryos or placentas were set as 1 and normalized to the internal control mouse gene Gapdh. The results are shown as the fold change (FC) = 2−ΔΔCt mean ± s.e.m.. All the primers for real-time PCR are listed in Table S1.
Embryo transfer
Eighteen morulae were transferred to 2.5 days post-coitum pseudo-pregnant ICR-recipient females. The pseudo-pregnant recipient females were obtained by mating with vasectomized males 2.5 days before the embryo transfers were performed. Only female mice with a visible plug were chosen as embryo recipients. For placenta analysis, the pseudo-pregnant mice were euthanized, and placentas were collected on E17.5. The placentas were stored at 4% PFA–PBS or liquid nitrogen until further analysis.
Histological analysis of placenta
Placentas were fixed in 4% PFA–PBS, then dehydrated through a series of alcohol baths, cleared in xylene and immersed in wax after appropriate embedding. Paraffin sections (5 μm thick) were cut from array blocks and transferred to glass slides, then stained with hematoxylin-eosin (H&E) and observed with conventional light microscope (Olympus). The percentage of the labyrinth in the total placenta was analyzed by ImageJ (NIH).
Bisulfite modification and DNA methylation analysis
Morula genomic DNA was modified with EZ DNA Methylation-Direct kit (Zymo Research, Orange, CA, USA). DNA from the placenta was exposed to bisulfite modification according to the manufacturer's instructions. PCR products were then amplified using bisulfite genome sequencing (BGS) primers and cloned into the PMD19T vector (TaKaRa, 6013). Colonies were randomly selected and sequenced by BGS. The primers used for Phlda2were– F:GGCAGAGGGTAAATAAAATCTTGC; R:AAGGCAGAGGGTAAATAAAAT.
Western blot analysis
The tissues were homogenized with RIPA buffer (Beyotime Institute of Biotechnology), phosphatase inhibitor and PMSF (1000:10:10) to extract the proteins. These proteins were separated on sodium dodecyl sulfate (SDS)-polyacrylamide gels, electrophoresed and transferred to nitrocellulose membranes. Proteins were mixed with Tris-buffered saline Tween with skim milk for 1 h. Proteins were incubated with β-Actin (1:8000, Abcam), Notch4 (1:2000, Abcam) at 4°C overnight. Finally, the secondary antibody (1:5000) was incubated for 1 h at 37°C to enhance chemiluminescence (Thermo) observation. Signal quantification was performed using the Image Lab system (Bio-Rad), and the relative intensities of the bands were analyzed using ImageJ software and normalized to β-Actin.
Data availability
All sequencing data related to this study have been deposited at Gene Expression Omnibus (GEO, https://www.ncbi.nlm.nih.gov/geo/) under the accession number GSE186660.
Statistical analysis
Results are expressed as the mean ± s.e.m. from at least three independent experiments. Statistical analyses were performed using t-tests and one-way analysis of variance (ANOVA) in SPSS version 18.0 (SPSS Inc.). Two-sided P<0.05 was considered significant.
Results
Effects of nicotine on early embryonic and placental development
To assess the effects of nicotine on early embryonic development, we cultured fertilized 1-cell embryos in vitro with different concentrations of nicotine for 96 h, and the embryo development percentages in 2-cell, 4-cell, 8-cell, morula and blastocyte stage were counted (Fig. 1A and B). Initially, we identified a broad range of concentrations used in previous studies involving various cell types, including ganglia cells, bovine early embryos and sperm (Gu et al. 2013), with treatment concentrations ranging from 0.5 mM to 10 mM. The results indicated that embryonic development was not affected by 1 mM nicotine treatment compared to the control. While under 1.5 mM nicotine treatment, although there was no significant difference in percentage of morula, the blastocyst formation rate was significantly decreased, decreasing by approximately 49% compared to the control group (Fig. 1B) (Liu et al. 2008). Differential interference contrast (DIC) demonstration for the 1.5 mM nicotine treatment showed that one-half of the morulae died, and the others which could develop into blastocyst appeared to have abnormalities (Fig. 1C).
Effects of nicotine treatment on early embryonic development and rise in placental weight. (A) Schematic diagram of the experimental design for the control and nicotine embryos; (B) percentage of embryos development at different stages by nicotine treatment. Results are shown as mean ± s.e.m.; (C) representative DIC images of embryos treated by 0 mM or 1.5 mM for 4.5 days. Scale bar, 100 μm; (D) percentage of implantation on E17.5 by nicotine treatment (n = 3). (E) Representative photos of placentas on E17.5. Scale bar, 3 mm; (F) placenta weight statistics for control and nicotine-treated group (unpaired samples t-test; *P < 0.05, ****P < 0.0001, ns P > 0.05).
Citation: Reproduction 166, 3; 10.1530/REP-22-0458
And then, the control and 1.5 mM nicotine-treated morula were transferred into the pseudo-pregnant dams and counted on the percentage of implantation at E17.5. We found that nicotine significantly impaired embryo implantation (Fig. 1D). Especially, the results indicated that nicotine exposure caused an extremely significant increase in E17.5 placental weight, which was approximately 1.58-fold heavier than the control group after nicotine treatment (Fig. 1E and F). Taken together, we concluded that nicotine exposure could significantly impair early embryonic development and subsequent placental development.
Histopathological changes of placenta after nicotine exposure
We next investigate the impact of nicotine on the placental tissues. The comparison of placental histomorphology revealed that there were abnormalities in the placental sponge trophoblast layer over-invasion of labyrinth trophoblast layer through nicotine treatment (Fig. 2A) (Yang et al. 2020). In addition, nicotine exposure caused common abnormal structures of the placenta such as fibrosis and thrombosis (Fig. 2B), which were reported as the important indexes for the placental development (Wardinger & Ambati 2021). We also observed the disrupted marker gene expression in nicotine-treated placentas, as indicated with decreased expression of sponge trophoblast marker genes and increased expression of labyrinth trophoblast marker genes (Fig. 2C). GCM1 is derived from extravillous trophoblasts (EVTs) (Jeyarajah et al. 2022), which ultimately develop into the labyrinth trophoblast layer of the placenta. Due to excessive invasion of the spongy trophoblasts into the labyrinthine trophoblasts, gene expression in this region is decreased. Similarly, the expression of the remaining genes (Prl2c2, Prl3b1, Prl3d1) is in the sponge trophoblast layer, and these gene expressions were upregulated. Among them, Thy1 is associated with fibrosis, and its upregulated expression corresponds to nicotine-induced placental fibrosis. A previous report indicated that Phlda2 was a maternally expressed imprinted gene which was associated with placental enlargement and the distribution of the sponge and labyrinth trophoblast layer (Angiolini et al. 2021). Interestingly, we detected an increased level of DNA methylation in the promoter region of Phlda2 by using bisulfite sequencing. As a result, the data displayed that the DNA methylation of Phlda2 promoter regions was increased from 25.0 to 38.6% (Fig. 2D). This result corresponds to the down-regulation of Phlda2 gene expression (Fig. 2C). The above results indicated that nicotine exposure during early embryonic development disrupted the expression of vital placental genes, increased placental weight and disrupted the placental structure.
Histopathological changes of placenta after nicotine exposure. (A) H&E-stained sections of E17.5 placenta from control (top) and nicotine-treated (bottom) group. Scale bar, 1.4 mm.; (B) abnormal placental structures including thrombosis (left) and fibrosis (right) after nicotine treatment. Scale bar, 100 μm; (C) expression of sponge trophoblast or labyrinth trophoblast marker genes and fibrosis maker gene in placenta treated with or without nicotine; (D) DNA methylation pattern of Phlda2 in placenta treated with or without nicotine assayed by bisulfite sequencing assay (unpaired-samples t-test; *P < 0.05).
Citation: Reproduction 166, 3; 10.1530/REP-22-0458
Nicotine treatment increases the levels of oxidative stress, DNA damage and apoptosis in morula
Recent reports indicated that nicotine impaired cellular homeostasis by inducing ROS and cell apoptosis in myocardial cells (Jia et al. 2020, Meng et al. 2021) and germ cells (Cheng et al. 2018). We then assessed the quality of the embryos after nicotine exposure by detecting the ROS, DNA damage and apoptosis, respectively. Since the nicotine treatment caused the death of morula during development to blastocyst, we therefore detected embryos at the morula stage. The results showed that both the ROS (Fig. 3A, Supplementary Fig. 1A, see section on supplementary materials given at the end of this article) and DNA damage (Fig. 3B) levels of nicotine-treated morulae were significantly higher than the control groups. Moreover, we found the level of early apoptosis by Annexin-V was also increased (Fig. 3C). The late apoptosis by TUNEL was only slightly increased after nicotine exposure (Fig. 3D). Although nicotine has previously been reported to cause epigenetic changes such as histone acetylation (Fan et al. 2019), we did not observe significant differences in H3K4me3, H3K27ac and H3K4me3 levels between control and nicotine-exposure groups (Supplementary Fig. 1B, C and D). These results show that nicotine could impair early embryonic development in the morula–blastocyst windows with cell apoptosis.
Nicotine treatment increases the levels of oxidative stress, DNA damage and apoptosis in morula. (A) Representative images of ROS levels detected by DHE–DA staining, in control (Ctr) and nicotine-treated (Nic) embryos. Scale bar, 20 μm. ROS fluorescence intensity detected in control (left) and nicotine-treated group (right); (B) representative images of DNA damage stained with the γH2AX antibody, in control and nicotine-treated embryos. Scale bar, 20 μm (left). γH2AX foci were counted in control and nicotine-treated group (right); (C) representative images of apoptotic status, assessed by Annexin-V staining, in control and nicotine-treated embryos. Scale bar, 20 μm (Left). FITC fluorescence intensity detected in control and nicotine-treated group (right); (D) representative images of apoptotic status, assessed by TUNEL assay, in control and nicotine-treated embryos. Scale bar, 20 μm (left). FITC fluorescence intensity detected in control and nicotine-treated group (right) (unpaired-samples t-test; **P < 0.01, ****P < 0.0001, ns P > 0.05).
Citation: Reproduction 166, 3; 10.1530/REP-22-0458
Nicotine treatment disrupts placental development at the transcriptional level in morula and TE
To investigate the upstream mechanism of the disturbance in placentas caused by nicotine, we collected morulae and separated ICM and TE from blastocyst and performed RNA-seq, respectively. Correlation analysis showed that nicotine-treated embryos were well distinguished from controls at morula, ICM and TE stages. Further PCA analysis showed a clear segregation of ICM and TE from nicotine-treated and control blastocyst (Supplementary Fig. 2A and B). The analysis of the RNA-seq shows that there were 263 genes up-regulated and 266 genes down-regulated by nicotine treatment in morula (Fig. 4A). And the GO enrichment analysis showed that these up-regulated genes were related to no plot showed that 3cell apoptotic process, DNA damage, placenta development and key signaling pathways such as Notch signaling pathway (Fig. 4B). Then, volcano plot showed 385 upregulated and 185 downregulated differentially expressed genes in nicotine exposure TE cells (Fig. 4C). The GO enrichment analysis indicated that upregulated genes were associated with toxic substance, apoptosis, placenta development and Notch signaling pathway, and downregulated genes were related to embryonic development (Fig. 4D). For example, we detected the upregulated expression of placental development master gene Cdx2 (van Nes et al. 2006) and the key gene of Notch signaling pathway by nicotine exposure (Fig. 4E and F). Because the Notch pathway is important for placental development, we examined the key gene expression of Notch signaling pathway in the placenta. Consistently, the qPCR analysis showed the Notch signaling pathway ligand and receptor were abnormally increased (Fig. 4G). Taken together, the above results showed that nicotine exposure disturbed the gene expression of placental development and excessive activation of the Notch signaling pathway at the embryonic stage.
Nicotine treatment disrupts placental development at the transcriptional level in morula and TE stages. (A) Volcano plot showing differentially expressed genes (DEGs; downregulated, blue; upregulated, red) in nicotine-treated morula compared with control; (B) volcano plot showing differentially expressed genes (DEGs; downregulated, blue; upregulated, red) in nicotine-treated TE compared with control; (C) GO terms analysis of upregulated and downregulated DEGs in nicotine-treated morula compared with control; (D) GO terms analysis of upregulated and downregulated DEGs in nicotine-treated TE compared with control; (E) example of Fpkm of placenta development gene expression in morula and TE; (F) example of Fpkm of Notch2 gene expression in morula and TE; (G) expression of notch signaling pathway related genes in placenta treated with or without nicotine. All graphs show mean ± s.e.m. (unpaired samples t-test; *P < 0.05).
Citation: Reproduction 166, 3; 10.1530/REP-22-0458
The negative impacts caused by nicotine are partly due to over-activation of the Notch signaling pathway
To further investigate whether nicotine exposure interferes with placental development by over-activation of Notch signaling pathway, we added Notch signaling pathway inhibitor DAPT into nicotine-treated group during mouse early embryonic development. We found that 50 µM concentration of DAPT did not affect the early embryonic development (Supplementary Fig. 3A). By qRT-PCR, we showed that the notch-associated ligands and receptor gene expression were significantly reduced by adding DAPT in morula (Fig. 5A). Expectedly, statistics on placental weight revealed that placentas treated by nicotine and DAPT were significantly lower than the placentas treated with nicotine, and there was no significant difference from that of the control placentas (Fig. 5B and C). Consistently, the addition of DAPT decreased the Notch signaling pathway key genes at both mRNA (Fig. 5D) and protein levels (Fig. 5E) in E17.5 placenta. Histopathological observation of the placenta revealed that nicotine treatment decreased the ratio of labyrinth trophoblast area to the total placenta area. In addition, DAPT treatment could partially rescue the labyrinth trophoblast area (Fig. 5F and G). These results demonstrated that nicotine exposure influences placental development partially by Notch signaling pathway.
The negative impact caused by nicotine are partly due to over-activation of the Notch signaling pathway. (A) Expression of notch signaling pathway-related genes in morula from control, nicotine or nicotine plus DAPT group (n = 3); (B) representative photos of placentas on E17.5. Scale bar, 1.3 mm; (C) placenta weight statistics for control, nicotine and nicotine plus DAPT group; (D) expression of notch signaling pathway-related genes in placenta from control, nicotine and nicotine plus DAPT group; (E) protein levels of placenta in control, nicotine and nicotine plus DAPT group; (F) H&E-stained sections of E17.5 placenta from control, nicotine and nicotine plus DAPT group; (G) the percentage of labyrinth area to total area in placental tissue. All graphs show mean ± s.e.m.(one-way ANOVA; *P < 0.05, **P < 0.01, ns P > 0.05).
Citation: Reproduction 166, 3; 10.1530/REP-22-0458
Discussion
Numerous studies have reported that nicotine exposure causes various degrees of disturbance to the brain, lungs, heart, kidneys and placental tissues. As for the impacts on reproduction, nicotine exposure has been shown to reduce sperm count and disrupt spermatogenesis (Jana et al. 2010). And spermatozoa exposure to 5 mM nicotine for 3 h leads to a decrease in total motility and triggers a spontaneous acrosome reaction (Oyeyipo et al. 2014). In females, nicotine exposure decreases primordial follicle assembly and thus affects ovarian reservation (Wang et al. 2018, Liu et al. 2020). Nicotine treatment resulted in delays in rat early embryo development and reduces embryonic cell numbers in vivo (Vuguin 2007) and disturbs bovine blastocyst formation in vitro. In this study, we used mice as a model to study the mechanism of nicotine's effects on early embryonic development in vitro. Meanwhile, we found that nicotine had a significant impact on early embryonic development, especially from the morula to blastocyst stage. Although in vitro experiments allow for better control of nicotine concentration, as nicotine rapidly metabolizes into metabolites such as cotinine and trans-3'-hydroxycotinine, and allow for a more focused study on the effects of nicotine specifically on early embryonic development (Pratt et al. 2023, von Weymarn et al. 2023), it is undeniable that our experiment has limitations. First, it is important to recognize that our experimental design does not fully replicate the complex interactions within the in vivo environment, which may restrict a complete understanding of the mechanisms responsible for the effects of nicotine on early embryonic development. Additionally, the utilization of an in vitro culture model for nicotine exposure fails to encompass the intricate in vivo metabolic processes associated with nicotine. Therefore, it is crucial to interpret our experimental findings as contributing to a partial understanding of the mechanisms involved in nicotine's influence on early embryonic development following in vivo nicotine exposure, rather than providing a comprehensive representation.
Maternal exposure to harmful substances in the environment needs to pass through the placental barrier and can affect fetal development. The structure of the placenta and the formation of blood vessels are important for the normal development of the fetus. A previous report showed that BPA exposure caused a decrease in placental spongiotrophoblast and irregular dilatation of vessels in the labyrinth trophoblast (Tait et al. 2015). Similarly, Zhang et al. found that DEHP exposure during pregnancy reduced placental size, interfered placental endocrine function, inhibited placental cell proliferation and disrupted placental structure (Zhang et al. 2020). Similarly, we found that during nicotine treatment, there was an excessive invasion of the placental sponge trophoblast layer into the labyrinth trophoblast layer, and nicotine also caused placental fibrosis and thrombosis. Formation of placental thrombosis can result in various adverse outcomes, and there is evidence suggesting that benzophenone-3 can also contribute to thrombosis in the placenta (Han et al. 2022). However, the mechanism underlying the formation of placental thrombosis remains elusive. Moreover, gene expression in the placenta also plays a vital role in the function of the placenta (Burton & Fowden 2012, Nakano et al. 2021). Our RNA-seq analysis of mulberry embryos, ICMs and TEs (Fig. 4, Supplementary Fig. 2C) demonstrated that nicotine can indeed affect placental development, although this does not necessarily mean that nicotine exposure will not affect fetal development. Previous reports suggest that nicotine can also affect many organs of the fetus (Bruin et al. 2010, Behl et al. 2013), but in our data, nicotine exposure during early embryonic development leads to abnormal placental development. Previously, it was shown that loss of imprinting and upregulation of Phlda2 expression resulted in placental growth retardation (Salas et al. 2004) and negative association with fetal birth weight (Apostolidou et al. 2007). In addition, Phlda2 has been shown to regulate the structure of the placenta. The depletion of Phlda2 inhibited the proliferation of spongiosa cells in the placenta, ultimately leading to reduced fetal weight (Tunster et al. 2016). In our experimental results, where nicotine exposure led to an increase the methylation level of the Phlda2 promoter region, decrease gene expression, increase placental weight and disrupt placental structure, but there was no effect on the fetus.
Accumulating evidence has revealed that nicotine could lead to excessive ROS accumulation. In rat ventricular myocytes, nicotine exposure increased mitochondrial ROS, further leading to excessive mitochondrial fission and ultimately cell apoptosis (Meng et al. 2021). Increased ROS level in cardiac mitochondria was found by treating rats with nicotine administration for 28 days (Ramalingam et al. 2021). Nicotine exposure led to ROS, DNA damage and increased levels of cell apoptosis during ovarian culture for 4 days in vitro (Cheng et al. 2018). Similarly, nicotine exposure during pregnancy also increased levels of intracellular ROS in the follicles of the offspring (Liu et al. 2020), fetal and neonatal pancreas (Bruin et al. 2008), demonstrating the negative impact of nicotine could be transmitted to the next generation. Consistently, our study showed that nicotine exposure increased ROS levels, which exhibits a weak manifestation as early as the eight-cell stage, as evidenced by the appearance of weak fluorescence at this stage, and induced cell apoptosis and further caused a decline in the embryonic quality.
The Notch signaling pathway contributes to placental angiogenesis (Huang et al. 2021), trophoblast migration and invasion (Luo et al. 2020) during placental development. Previous studies have shown that genes such as Notch2 and Notch4 are essential for placental development (Herr et al. 2011). Through conditional knockout of endothelial Notch1, Limbourg et al. found embryonic death at 10.5 days and observed that blood vessels failed to invade the labyrinth placenta (Limbourg et al. 2005). Yu et al. found that trophoblast cell migration and invasion were inhibited by knocking down Notch1 (Yu et al. 2014). Conditional knockdown of Notch2 demonstrates that the Notch signaling pathway is critical in placental trophoblasts endovascular invasion (Hunkapiller et al. 2011). This indicates a critical role of the Notch signaling pathway in placental development, which is also observed in our experiments. We found that nicotine exposure significantly increased the gene expression of Notch signaling pathway both in embryos and in placentas. Moreover, recent studies have shown that the perfluorooctanoic acid (PFOA) affects placental development by acting on the Notch signaling pathway. PFOA exposure disrupts placental angiogenesis, and inadequate placental vascularization was found to be as an important factor contributing to preeclampsia and low birth weight (Poteser et al. 2020). Similarly, our experiments demonstrated that nicotine exposure induced the over-activation of the Notch signaling pathway and also destroyed the placental structure. Furthermore, by adding the Notch signaling pathway inhibitor DAPT, we found that the perturbation of placental weight and structure was reduced.
In summary, our study demonstrated that nicotine exposure decreased blastocyst formation due to induced ROS accumulation, DNA damage and cell apoptosis. It also partially disrupted placental gene expression, imprinted gene methylation levels and placental structure by over-activating the Notch signaling pathway during pre-implantation embryonic development.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-22-0458.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.
Funding
This work was supported by the National Key Research and Development Program of China (2018YFC1004304), Hubei Province Science and Technology Basic Conditions Platform (2020DFE020), Key Research and Development Program of Hubei Province (no. 2021BBA221), Fundamental Research Funds for the Central Universities (no. 2662022DKPY001), Major Project of Hubei Hongshan Laboratory (no. 2021hszd003), Hubei Province Key Laboratory of Occupational Hazard Identification and Control Ppen Grant (OHIC2021G13).
Author contribution statement
QRS and DYW conducted the experiments; QRS, JJZ and LHW analyzed the data, QRS, DYW and YLM designed the experiment and QRS, XZ, JZ and YLM wrote the manuscript. All authors reviewed the manuscript.
References
Alfred V & & Vaccari T 2018 Mechanisms of non-canonical signaling in health and disease: diversity to take therapy up a notch? Advances in Experimental Medicine and Biology 1066 187–204. (https://doi.org/10.1007/978-3-319-89512-3_9)
Angiolini E, Sandovici I, Coan PM, Burton GJ, Sibley CP, Fowden AL & & Constancia M 2021 Deletion of the imprinted Phlda2 gene increases placental passive permeability in the mouse. Genes 12. (https://doi.org/10.3390/genes12050639)
Apostolidou S, Abu-Amero S, O'Donoghue K, Frost J, Olafsdottir O, Chavele KM, Whittaker JC, Loughna P, Stanier P & & Moore GE 2007 Elevated placental expression of the imprinted PHLDA2 gene is associated with low birth weight. Journal of Molecular Medicine 85 379–387. (https://doi.org/10.1007/s00109-006-0131-8)
Batista MR, Diniz P, Murta D, Torres A, Lopes-da-Costa L & & Silva E 2021 Balanced Notch-Wnt signaling interplay is required for mouse embryo and fetal development. Reproduction 161 385–398. (https://doi.org/10.1530/REP-20-0435)
Behl M, Rao D, Aagaard K, Davidson TL, Levin ED, Slotkin TA, Srinivasan S, Wallinga D, White MF & Walker VR et al.2013 Evaluation of the association between maternal smoking, childhood obesity, and metabolic disorders: a national toxicology program workshop review. Environmental Health Perspectives 121 170–180. (https://doi.org/10.1289/ehp.1205404)
Borggrefe T & & Oswald F 2009 The Notch signaling pathway: transcriptional regulation at Notch target genes. Cellular and Molecular Life Sciences 66 1631–1646. (https://doi.org/10.1007/s00018-009-8668-7)
Bray SJ 2016 Notch signalling in context. Nature Reviews. Molecular Cell Biology 17 722–735. (https://doi.org/10.1038/nrm.2016.94)
Bruin JE, Petre MA, Lehman MA, Raha S, Gerstein HC, Morrison KM & & Holloway AC 2008 Maternal nicotine exposure increases oxidative stress in the offspring. Free Radical Biology and Medicine 44 1919–1925. (https://doi.org/10.1016/j.freeradbiomed.2008.02.010)
Bruin JE, Gerstein HC & & Holloway AC 2010 Long-term consequences of fetal and neonatal nicotine exposure: a critical review. Toxicological Sciences 116 364–374. (https://doi.org/10.1093/toxsci/kfq103)
Burton GJ & & Fowden AL 2012 Review: the placenta and developmental programming: balancing fetal nutrient demands with maternal resource allocation. Placenta 33(Supplement) S23–S27. (https://doi.org/10.1016/j.placenta.2011.11.013)
Cheng SF, Qin XS, Han ZL, Sun XF, Feng YN, Yang F, Ge W, Li L, Zhao Y & De Felici M et al.2018 Nicotine exposure impairs germ cell development in human fetal ovaries cultured in vitro. Aging 10 1556–1574. (https://doi.org/10.18632/aging.101492)
Dahlstrom A, Lundell B, Curvall M & & Thapper L 1990 Nicotine and cotinine concentrations in the nursing mother and her infant. Acta Paediatrica Scandinavica 79 142–147. (https://doi.org/10.1111/j.1651-2227.1990.tb11430.x)
Das S, Neogy S, Gautam N & & Roy S 2009 In vitro nicotine induced superoxide mediated DNA fragmentation in lymphocytes: protective role of Andrographis paniculata Nees. Toxicology in Vitro 23 90–98. (https://doi.org/10.1016/j.tiv.2008.10.012)
Falo-Sanjuan J & & Bray S 2022 Notch-dependent and -independent transcription are modulated by tissue movements at gastrulation. eLife 11. (https://doi.org/10.7554/eLife.73656)
Fan G, Zhang Q, Wan Y, Lv F, Chen Y, Ni Y, Zou W, Zhang W & & Wang H 2019 Decreased levels of H3K9ac and H3K27ac in the promotor region of ovarian P450 aromatase mediated low estradiol synthesis in female offspring rats induced by prenatal nicotine exposure as well as in human granulosa cells after nicotine treatment. Food and Chemical Toxicology 128 256–266. (https://doi.org/10.1016/j.fct.2019.03.055)
Gasperowicz M & & Otto F 2008 The notch signalling pathway in the development of the mouse placenta. Placenta 29 651–659. (https://doi.org/10.1016/j.placenta.2008.06.004)
Gibbs K, Collaco JM & & McGrath-Morrow SA 2016 Impact of tobacco smoke and nicotine exposure on lung development. Chest 149 552–561. (https://doi.org/10.1378/chest.15-1858)
Gu YH, Li Y, Huang XF, Zheng JF, Yang J, Diao H, Yuan Y, Xu Y, Liu M & Shi HJ et al.2013 Reproductive effects of two neonicotinoid insecticides on mouse sperm function and early embryonic development in vitro. PLoS One 8 e70112. (https://doi.org/10.1371/journal.pone.0070112)
Guruharsha KG, Kankel MW & & Artavanis-Tsakonas S 2012 The Notch signalling system: recent insights into the complexity of a conserved pathway. Nature Reviews. Genetics 13 654–666. (https://doi.org/10.1038/nrg3272)
Han X, Lu T, Hu Y, Duan J, Guan Y, Huang X, Zhou J, Huang R, Tang M & Sun R et al.2022 A metabolomic study on the effect of prenatal exposure to Benzophenone-3 on spontaneous fetal loss in mice. Ecotoxicology and Environmental Safety 233 113347. (https://doi.org/10.1016/j.ecoenv.2022.113347)
Henderson BJ & & Lester HA 2015 Inside-out neuropharmacology of nicotinic drugs. Neuropharmacology 96 178–193. (https://doi.org/10.1016/j.neuropharm.2015.01.022)
Herr F, Schreiner I, Baal N, Pfarrer C & & Zygmunt M 2011 Expression patterns of Notch receptors and their ligands Jagged and Delta in human placenta. Placenta 32 554–563. (https://doi.org/10.1016/j.placenta.2011.04.018)
Holbrook BD 2016 The effects of nicotine on human fetal development. Birth Defects Research. Part C, Embryo Today: Reviews 108 181–192. (https://doi.org/10.1002/bdrc.21128)
Hoo R, Nakimuli A & & Vento-Tormo R 2020 Innate immune mechanisms to protect against infection at the human decidual-placental interface. Frontiers in Immunology 11 2070. (https://doi.org/10.3389/fimmu.2020.02070)
Huang Z, Huang S, Song T, Yin Y & & Tan C 2021 Placental angiogenesis in mammals: a review of the regulatory effects of signaling pathways and functional nutrients. Advances in Nutrition 12 2415–2434. (https://doi.org/10.1093/advances/nmab070)
Hunkapiller NM, Gasperowicz M, Kapidzic M, Plaks V, Maltepe E, Kitajewski J, Cross JC & & Fisher SJ 2011 A role for Notch signaling in trophoblast endovascular invasion and in the pathogenesis of pre-eclampsia. Development 138 2987–2998. (https://doi.org/10.1242/dev.066589)
Jana K, Samanta PK & & De DK 2010 Nicotine diminishes testicular gametogenesis, steroidogenesis, and steroidogenic acute regulatory protein expression in adult albino rats: possible influence on pituitary gonadotropins and alteration of testicular antioxidant status. Toxicological Sciences 116 647–659. (https://doi.org/10.1093/toxsci/kfq149)
Jeyarajah MJ, Jaju Bhattad G, Kelly RD, Baines KJ, Jaremek A, Yang FP, Okae H, Arima T, Dumeaux V & & Renaud SJ 2022 The multifaceted role of GCM1 during trophoblast differentiation in the human placenta. PNAS 119 e2203071119. (https://doi.org/10.1073/pnas.2203071119)
Jia G, Meng Z, Liu C, Ma X, Gao J, Liu J, Guo R, Yan Z, Christopher T & Lopez B et al.2020 Nicotine induces cardiac toxicity through blocking mitophagic clearance in young adult rat. Life Sciences 257 118084. (https://doi.org/10.1016/j.lfs.2020.118084)
Limbourg FP, Takeshita K, Radtke F, Bronson RT, Chin MT & & Liao JK 2005 Essential role of endothelial Notch1 in angiogenesis. Circulation 111 1826–1832. (https://doi.org/10.1161/01.CIR.0000160870.93058.DD)
Liu Y, Li GP, Sessions BR, Rickords LF, White KL & & Bunch TD 2008 Nicotine induces multinuclear formation and causes aberrant embryonic development in bovine. Molecular Reproduction and Development 75 801–809. (https://doi.org/10.1002/mrd.20774)
Liu WX, Tan SJ, Wang YF, Li L, Sun XF, Liu J, Klinger FG, De Felici M, Shen W & & Cheng SF 2020 Melatonin ameliorates murine fetal oocyte meiotic dysfunction in F1 and F2 offspring caused by nicotine exposure during pregnancy. Environmental Pollution 263 114519. (https://doi.org/10.1016/j.envpol.2020.114519)
Lu J, Wu W, Xin Q, Zhou C, Wang J, Ni Z, Liu D, Xu Y, Yu Y & Yang N et al.2019 Spatiotemporal coordination of trophoblast and allantoic Rbpj signaling directs normal placental morphogenesis. Cell Death and Disease 10 438. (https://doi.org/10.1038/s41419-019-1683-1)
Luo Q, Zhang W, Liu X, Zheng Y, Gao H, Zhao Y & & Zou L 2020 Delta-Like 4-Notch signaling regulates trophoblast migration and invasion by targeting EphrinB2. Biochemical and Biophysical Research Communications 527 915–921. (https://doi.org/10.1016/j.bbrc.2020.05.032)
Mahajan SD, Homish GG & & Quisenberry A 2021 Multifactorial etiology of adolescent nicotine addiction: a review of the neurobiology of nicotine addiction and its implications for Smoking Cessation pharmacotherapy. Frontiers in Public Health 9 664748. (https://doi.org/10.3389/fpubh.2021.664748)
Meng TT, Wang W, Meng FL, Wang SY, Wu HH, Chen JM, Zheng Y, Wang GX, Zhang MX & Li Y et al.2021 Nicotine causes mitochondrial dynamics imbalance and apoptosis through ROS Mediated Mitophagy impairment in cardiomyocytes. Frontiers in Physiology 12 650055. (https://doi.org/10.3389/fphys.2021.650055)
Nakano T, Aochi H, Hirasaki M, Takenaka Y, Fujita K, Tamura M, Soma H, Kamezawa H, Koizumi T & Shibuya H et al.2021 Effects of PPARgamma1 deletion on late-stage murine embryogenesis and cells that undergo endocycle. Developmental Biology 478 222–235. (https://doi.org/10.1016/j.ydbio.2021.07.003)
Nordenstam F 2021 Prenatal nicotine exposure was associated with long-term impact on the cardiovascular system and regulation-Review. Acta Paediatrica 110 2536–2544. (https://doi.org/10.1111/apa.15914)
Oyeyipo IP, Maartens PJ & & du Plessis SS 2014 In vitro effects of nicotine on human spermatozoa. Andrologia 46 887–892. (https://doi.org/10.1111/and.12169)
Perlman BE, Merriam AA, Lemenze A, Zhao Q, Begum S, Nair M, Wu T, Wapner RJ, Kitajewski JK & Shawber CJ et al.2021 Implications for preeclampsia: hypoxia-induced Notch promotes trophoblast migration. Reproduction 161 681–696. (https://doi.org/10.1530/REP-20-0483)
Poteser M, Hutter HP, Moshammer H & & Weitensfelder L 2020 Perfluoroctanoic acid (PFOA) enhances NOTCH-signaling in an angiogenesis model of placental trophoblast cells. International Journal of Hygiene and Environmental Health 229 113566. (https://doi.org/10.1016/j.ijheh.2020.113566)
Pratt K, Hilty A, Jacob P & & Schick SF 2023 Respiratory exposure to thirdhand cigarette smoke increases concentrations of urinary metabolites of nicotine. Nicotine and Tobacco Research. (https://doi.org/10.1093/ntr/ntad002)
Ramalingam A, Fauzi NMohd, Budin SB & & Zainalabidin S 2021 Impact of prolonged nicotine administration on myocardial function and susceptibility to ischaemia-reperfusion injury in rats. Basic and Clinical Pharmacology and Toxicology 128 322–333. (https://doi.org/10.1111/bcpt.13500)
Salas M, John R, Saxena A, Barton S, Frank D, Fitzpatrick G, Higgins MJ & & Tycko B 2004 Placental growth retardation due to loss of imprinting of Phlda2. Mechanisms of Development 121 1199–1210. (https://doi.org/10.1016/j.mod.2004.05.017)
Suter MA & & Aagaard KM 2020 The impact of tobacco chemicals and nicotine on placental development. Prenatal Diagnosis 40 1193–1200. (https://doi.org/10.1002/pd.5660)
Tait S, Tassinari R, Maranghi F & & Mantovani A 2015 Bisphenol A affects placental layers morphology and angiogenesis during early pregnancy phase in mice. Journal of Applied Toxicology 35 1278–1291. (https://doi.org/10.1002/jat.3176)
Tunster SJ, Creeth HDJ & & John RM 2016 The imprinted Phlda2 gene modulates a major endocrine compartment of the placenta to regulate placental demands for maternal resources. Developmental Biology 409 251–260. (https://doi.org/10.1016/j.ydbio.2015.10.015)
van Nes J, de Graaff W, Lebrin F, Gerhard M, Beck F & & Deschamps J 2006 The Cdx4 mutation affects axial development and reveals an essential role of Cdx genes in the ontogenesis of the placental labyrinth in mice. Development 133 419–428. (https://doi.org/10.1242/dev.02216)
von Weymarn LB, Lu X, Thomson NM, LeMarchand L, Park SL & & Murphy SE 2023 Quantitation of ten urinary nicotine metabolites, including 4-hydroxy-4-(3-pyridyl) butanoic acid, a product of nicotine 2'-oxidation, and CYP2A6 activity in Japanese Americans, native Hawaiians, and whites. Chemical Research in Toxicology 36 313–321. (https://doi.org/10.1021/acs.chemrestox.2c00413)
Vuguin PM 2007 Animal models for small for gestational age and fetal programming of adult disease. Hormone Research 68 113–123. (https://doi.org/10.1159/000100545)
Wang YF, Sun XF, Han ZL, Li L, Ge W, Zhao Y, De Felici M, Shen W & & Cheng SF 2018 Protective effects of melatonin against nicotine-induced disorder of mouse early folliculogenesis. Aging 10 463–480. (https://doi.org/10.18632/aging.101405)
Wardinger JE & & Ambati S 2021 Placental Insufficiency. Treasure Island , FL: StatPearls.
Warner GR, Dettogni RS, Bagchi IC, Flaws JA & & Graceli JB 2021 Placental outcomes of phthalate exposure. Reproductive Toxicology 103 1–17. (https://doi.org/10.1016/j.reprotox.2021.05.001)
Wong MK, Nicholson CJ, Holloway AC & & Hardy DB 2015 Maternal nicotine exposure leads to impaired disulfide bond formation and augmented endoplasmic reticulum stress in the rat placenta. PLoS One 10 e0122295. (https://doi.org/10.1371/journal.pone.0122295)
Yang HW, Hwang KJ, Kwon HC, Kim HS, Choi KW & & Oh KS 1998 Detection of reactive oxygen species (ROS) and apoptosis in human fragmented embryos. Human Reproduction 13 998–1002. (https://doi.org/10.1093/humrep/13.4.998)
Yang B, Wang X, Ma Y, Yan L, Ren Y, Yu D, Qiao B, Shen X, Liu H & Zhang D et al.2020 Tri-ortho-cresyl phosphate (TOCP)-induced reproductive toxicity involved in placental apoptosis, autophagy and oxidative stress in pregnant mice. Environmental Toxicology 35 97–107. (https://doi.org/10.1002/tox.22846)
Yu Y, Wang L, Tang W, Zhang D & & Shang T 2014 RNA interference-mediated knockdown of Notch-1 inhibits migration and invasion, down-regulates matrix metalloproteinases and suppresses NF-kappaB signaling pathway in trophoblast cells. Acta Histochemica 116 911–919. (https://doi.org/10.1016/j.acthis.2014.03.003)
Zhang S, Sun C, Zhao S, Wang B, Wang H, Zhang J, Wang Y, Cheng H, Zhu L & Shen R et al.2020 Exposure to DEHP or its metabolite MEHP promotes progesterone secretion and inhibits proliferation in mouse placenta or JEG-3 cells. Environmental Pollution 257 113593. (https://doi.org/10.1016/j.envpol.2019.113593)
Zhao Z & & Reece EA 2005 Nicotine-induced embryonic malformations mediated by apoptosis from increasing intracellular calcium and oxidative stress. Birth Defects Research. Part B, Developmental and Reproductive Toxicology 74 383–391. (https://doi.org/10.1002/bdrb.20052)
