Abstract
In brief
Failure to induce mesenchymal–epithelial transition (MET) during stromal cell decidualization can lead to consequences such as impaired fertility in patients with endometriosis. METTL3-mediated m6A modification plays an important role in attenuating MET and defective decidualization of endometrial stromal cells and contributes to the development of reduced endometrial receptivity in endometriosis.
Abstract
Mesenchymal–epithelial transition (MET)-mediated endometrial decidualization is pivotal for achieving endometrial receptivity and successful pregnancy. We observed blockade of MET in the eutopic secretory endometrium of patients with endometriosis, but the underlying mechanism is unknown. In this study, real-time PCR was used to detect PRL and IGFBP1 expression, whereas western blotting was used to detect the expression of MET markers and METTL3. Phalloidin staining was used to identify changes in cell morphology. M6A levels were quantified using a colorimetric method and m6A dot blots, and functional analysis was performed using spheroid adhesion assays. We first found that increased E-cadherin expression was accompanied by decreased vimentin and Slug expression in the eutopic secretory endometrium of individuals with endometriosis. We also detected a significant increase in both the m6A level and the expression of the related methyltransferase METTL3. Finally, METTL3 expression was negatively correlated with PRL, IGFBP1, and MET markers expression. Collectively, our findings suggest that METTL3 mediates m6A modification, thereby inhibiting MET formation within the eutopic secretory endometrium of patients with endometriosis. Increased METTL3-mediated m6A modification plays a crucial role in attenuating MET formation and decidualization impairment in endometrial stromal cells, ultimately contributing to compromised endometrial receptivity in individuals with endometriosis. These insights could lead to the identification of potential therapeutic targets for improving both endometrial receptivity and pregnancy rate among individuals affected by endometriosis.
Introduction
Endometriosis is a benign gynecological disorder that affects up to 10% of women during their reproductive years and can lead to both pain and infertility (Giudice 2010). Additionally, it represents one of the primary causes of female infertility (Bonavina & Taylor 2022). According to relevant statistics, approximately half of women diagnosed with endometriosis experience infertility (Bonavina & Taylor 2022, Tanbo & Fedorcsak 2017). Treatment of endometriosis in the setting of infertility raises numerous complex clinical questions. Elucidating the mechanisms underlying infertility issues associated with endometriosis is a significant challenge.
The reason why endometriosis causes infertility or a decrease in fecundity remains unknown. Several findings suggest that aberrations in endometrial function may contribute to the observed decrease in fecundity among women with endometriosis (Lessey & Kim 2017, Liu & Lang 2011, Minici et al. 2008). Decidualization of endometrial stromal cells (ESCs) is a crucial process for preparing the endometrium for embryo implantation. During decidualization, ESCs undergo morphological transformation from fibroblastic stromal cells to larger, rounder, and secretory decidual cells, which involves mesenchymal–epithelial transition (MET) (Owusu-Akyaw et al. 2019, Yu et al. 2016, Zhang et al. 2012). A characteristic feature of MET is the upregulation of E-cadherin expression in stromal cells accompanied by the downregulation of mesenchymal proteins, such as vimentin (Bakir et al. 2020, Dongre & Weinberg 2019, Heuberger & Birchmeier 2010, Jolly et al. 2017). Failure to induce MET formation during stromal cell decidualization can lead to consequences such as impaired fertility in patients with endometriosis.
N6-methyladenosine (m6A) is the most abundant internal modification of mRNAs and ncRNAs (Chen et al. 2020, Lin et al. 2022). In mammalian cells, the biological effects of m6A modification are dynamically and reversibly regulated by methyltransferases (writers) including WTAP, METTL3, METTL14, and KIAA1429; demethylases (erasers), including FTO and ALKBH5; and m6A-binding proteins (readers), including the YTH domain (Chen et al. 2019, Huang et al. 2021). Our previous study demonstrated that suppressing METTL3 promoted the migration and invasion of ESCs in endometriosis through the METTL3/m6A/miR126 axis (Li et al. 2021). Subsequent studies have shown similar results, indicating that METTL3 knockout promotes the migration and invasion of human ESCs, thereby contributing to the development of endometriosis (Chen et al. 2022, Zhao et al. 2022). Taken together, these findings indicate that dysregulated m6A modification plays a crucial role in the pathogenesis of endometriosis. However, previous studies have focused on the significance of m6A and its regulators in the pathogenesis of endometriosis, and studies on the relationship between m6A and endometriosis-associated infertility are rare. Many previous studies have demonstrated that the m6A modification of mRNAs increases in cancer cells during EMT and plays a critical role in cancer cell metastasis (Lin et al. 2019, Yue et al. 2019). MET and EMT are known to represent reversible transitions between epithelial and mesenchymal cellular phenotypes (Bakir et al. 2020, Chen et al. 2017). Based on the aforementioned research findings, we hypothesized that m6A is involved in the regulation of MET or EMT, which is associated with disrupted decidualization in endometriosis-associated infertility.
In this study, we aimed to demonstrate the functional role of m6A modification in cellular decidualization. Moreover, we explored whether abnormal m6A modification and METTLE expression are involved in endometriosis-related infertility and elucidated the potential underlying mechanisms involved. This finding offers a new therapeutic target for improving endometrial receptivity and increasing the pregnancy rate of patients with endometriosis-associated infertility.
Materials and methods
Patients and tissues
Patients of reproductive age (aged 25–41 years) who received treatment at the Department of Obstetrics and Gynaecology, Union Hospital, were enrolled in this study. Secretory endometrial tissues were obtained from 13 patients diagnosed with stage III or IV endometriosis based on both pathological and laparoscopic findings according to the revised classification of the American Fertility Society. Normal secretory endometrial tissues were collected from 14 fertile women with regular menstrual cycles whose infertility was attributed to tubal factors. All secretory-phase endometria were collected for immunohistochemistry analysis. Additionally, a total of 40 proliferative endometrial tissues were collected from 20 patients with endometriosis and 20 normal patients for cell experiments. All patients had regular menstrual cycles, had no other underlying endocrine, immune, or metabolic diseases, and had not received hormone therapy for at least 3 months prior to the study. This study was approved by the Medical Ethics Committee of Union Hospital, Tongji Medical College, Huazhong University of Science and Technology ([2020] IEC-J (112)), and all patients signed informed consent forms. The clinical characteristics of the patients are shown in Table 1.
Clinical classification of patients. Data are presented as n or as mean ± S.D.
| Characteristics | Normal | Endometriosis |
|---|---|---|
| Cases | 34 | 33 |
| Age, years | 31.79 ± 4.5 | 33.12 ± 3.6 |
| Menstrual phase | ||
| Proliferative | 20 | 20 |
| Secretory | 14 | 13 |
| rASRM classification | ||
| I | 0 | |
| II | 0 | |
| III | 25 | |
| IV | 8 |
rASRM, revised American Society for Reproductive Medicine.
Immunohistochemistry
The procedures for obtaining immunohistochemical (IHC) paraffin sections were performed as previously described (Xiong et al. 2016). The paraffin sections were subsequently incubated separately overnight at 4°C with the following primary antibodies: anti-E-cadherin (1:3000; Proteintech, China), anti-vimentin (1:400; Affinity, USA), anti-Slug (1:200; Affinity), and anti-METTL3 (1:400; Abcam). The staining intensity and percentage of protein expression in all paraffin sections were independently evaluated by two pathologists using a semiquantitative grading system known as the H-score (Remmele & Schicketanz 1993, Xiong et al. 2019). The details of the antibodies used can be found in Table 2.
Commercial sources and characteristics of antibodies used.
| Antibody | Dilution | Isotype | Product details | Location | |||
|---|---|---|---|---|---|---|---|
| IHC | WB | M6A dot | Number | Manufacturer | |||
| E-cadherin | 1:3000 | 1:1000 | – | Rabbit IgG | 20874-1-AP | Proteintech | China |
| Vimentin | 1:400 | 1:1000 | – | Rabbit IgG | #AF7031 | Affinity | USA |
| Slug | 1:200 | 1:1000 | – | Rabbit IgG | #DF6202 | Affinity | USA |
| METTL3 | 1:400 | 1:1000 | – | Rabbit IgG | Ab195352 | Abcam | USA |
| ACTB | – | 1:10,000 | – | Rabbit IgG | AC0338 | ABclonal | USA |
| M6A | – | – | 1:1000 | Rabbit IgG | A19841 | ABclonal | USA |
| IgG | 1:2000 | 1:4000 | 1:4000 | Goat anti-rabbit IgG | Ab150077 | Abcam | USA |
Cell culture
Fresh endometrial tissues were dissected using scissors and then digested with prewarmed collagenase II (Sigma-Aldrich) at 37°C for 45 min with continuous shaking. Following digestion, the tissue fragments were filtered through 150 μm and 37.4 μm sieves to isolate ESCs from other components. The isolated ESCs were subsequently lysed in red blood cell lysis buffer (Solarbio, Beijing, China) at room temperature for 7 min to remove erythrocytes. Next, the ESCs were resuspended in phenol red-free DMEM/Nutrient Mixture F-12 medium (DMEM/F-12; LanHeng Era, Wuhan, China) supplemented with 20% activated charcoal-absorbed fetal bovine serum (FBS; New Zealand), penicillin (100 U/mL), and streptomycin (100 μg/mL) (NCM Biotech, Suzhou, China). The identities of normal endometrial stromal cells (NESCs) and endometriosis endometrial stromal cells (EESCs) were confirmed using immunofluorescence staining (Supplementary File 1, see section on supplementary materials given at the end of this article). In addition, immortalized human endometrial stromal cells (IHESCs; ATCC) were cultured in DMEM/F-12 medium supplemented with 10% FBS. Both cell lines were maintained under a humidified atmosphere with 5% CO2 at 37°C.
Cell transfection assay
For the transfection experiments, the METTL3 overexpression plasmid and vector were synthesized by Hanbio Company (Shanghai, China), and the METTL3 siRNA and negative control were synthesized by DesignGene Company (Shanghai, China). The details of the METTL3 overexpression plasmids and METTL3 siRNA used are shown in Supplementary File 2 and Table 3. Confluent IHESCs were cultured at the time of transfection. These plasmids or siRNAs were transfected into cells using jetPRIME reagent (Polyplus, Strasbourg, France) according to the manufacturer’s protocol. The expression of markers was measured in transfected IHESCs after decidualization in vitro.
Details of siRNA.
| siRNA | Sequences | |
|---|---|---|
| Forward | Reverse | |
| METTL3 siRNA | GCAAGAAUUCUGUGACUAUTT | AUAGUCACAGAAUUCUUGCTT |
| METTL3 si-NC | UUCUCCGAACGUCUCACGUTT | ACGUGACACGUUCGGAGAATT |
Decidualization in vitro
The cells were maintained in DMEM/F12 medium for 24 h to synchronize the cell cycle to the G0/G1 phase. Next, the medium was replaced with DMEM/F12 containing 2% FBS, 10 nM estradiol (E2; AbMole, Shanghai, China), 100 nM medroxyprogesterone acetate (MPA; Selleck, Houston, TX, USA), and 500 μM cAMP (Selleck).
Western blotting
The total proteins extracted from the cultured cells were lysed in radioimmunoprecipitation assay buffer (NCM Biotech) containing PMSF (Servicebio, Wuhan, China) and Protease Inhibitor Cocktail (MedChemExpress, NJ, USA). The protein concentrations of the lysates were quantified using a BCA protein assay kit (Vazyme, China), followed by boiling at 95°C for 10 min. Equal amounts of proteins (30 μg) were separated using 10% SDS-PAGE and then transferred to PVDF membranes (Millipore). Subsequently, the membranes were incubated with 5% fat-free dried milk powder in Tris-HCl buffered saline containing 0.1% Tween 20 (TBST) at room temperature for 1 h. Following this step, the membranes were separately incubated overnight at 4°C with the following primary antibodies: anti-E-cadherin (1:1000; Proteintech), anti-vimentin (1:1000; Affinity), anti-Slug (1:1000; Affinity), anti-METTL3 (1:1000; Abcam) or anti-β-actin (1:10,000; ABclonal, USA). After washing with TBST and incubating with a secondary anti-rabbit antibody (1:4000; AbClonal), the proteins were treated with ECL detection reagent (Biology, China) for a few seconds before being visualized using a chemiluminescence gel imaging system (UVP, CA, USA). The details of the antibodies used can be found in Table 2.
Quantitative RT-PCR (qRT-PCR)
Total RNA was isolated from frozen tissues and cultured cells using TRIzol reagent (HYCEZMBIO, Wuhan, China) according to the manufacturer’s recommendations. Reverse transcription was performed using commercial RNA extraction kits (HiScript III RT SuperMix for qPCR, Vazyme), and 4 μL of gDNA wiper mix was added in the first step to remove genomic DNA from the RNA. Quantitative real-time polymerase chain reaction (qRT-PCR) was conducted with SYBR Green I (2×TSINGKE® Master QPCR Mix; China). Quantification of mRNA expression was performed with qRT-PCR using StepOne and StepOnePlus Real-Time PCR Systems (ABI, USA), and β-actin served as an internal control. All the data were calculated via the 2−△△CT method. The primer sequences utilized for qRT-PCR are listed in Table 4. As a classic internal reference gene, β-actin has been used as an internal reference gene in many previous studies with high scores (Dharmaraj et al. 2014, Lee et al. 2014).
Primer characteristics.
| Primer | Sequence | TM | AS | AE, % |
|---|---|---|---|---|
| PRL | 75 | 101.39 | ||
| Forward | GGAGCAAGCCCAACAGATGAA | 58.09 | ||
| Reverse | GGCTCATTCCAGGATCGCAAT | 57.98 | ||
| IGFBP1 | 88 | 100.8 | ||
| Forward | TCACAGCAGACAGTGTGAGAC | 57.01 | ||
| Reverse | CCCAGGGATCCTCTTCCCAT | 59.29 | ||
| METTL3 | 111 | 94.42 | ||
| Forward | GCTGTGGCAGAAAAGAAGGG | 56.99 | ||
| Reverse | GACTAACGAACTGGCAAAGGC | 56.71 | ||
| ACTB | 101 | 99 | ||
| Forward | TTGCCGACAGGATGCAGAA | 57.14 | ||
| Reverse | GCCGATCCACACGGAGTACT | 59.83 |
AS, amplicon size; AE, amplification efficiency.
RNA m6A quantification
The m6A content in total RNA was measured using the EpiQuik m6A RNA Methylation Quantification kit (colorimetric, EpigenTek, Carlsbad, USA) according to the manufacturer’s instructions. In brief, 200 ng of RNAs were introduced into the strip wells, followed by the addition of a high-affinity RNA solution. The capture antibody and detection antibody solutions were added to the wells at the appropriate dilutions. Subsequently, the m6A levels were quantified colorimetrically by measuring the absorbance of each well at a wavelength of 450 nm. The data were processed using relative quantification. The following equation was used for m6A calculation: [(RNA OD value − NC OD value) ÷ 200/(PC OD value −NC OD value)] × 100%. The PC and NC are reagents provided with the kit.
M6A dot blot experiment
Briefly, 200 ng of the sample was transferred onto N+ nylon membranes (Servicebio), and crosslinked using UV light. The membranes were then blocked and incubated with an anti-m6A antibody (1:1000; ABclonal) overnight at 4°C, followed by incubation with a secondary anti-rabbit antibody at room temperature for 1 h. Finally, the signals were visualized using a chemiluminescence gel imaging system. To ensure equal RNA localization, the membranes were stained with 0.02% methylene blue and subsequently washed with RNase-free water.
Cell implantation in vitro
Next, 20 mg of methylcellulose and 400,000 HTR8 cells were added to 5 mL of 1640 medium supplemented with 10% FBS (Procell, Wuhan, China), followed by the addition of PBS (LanHeng Era) until a final volume of 10 mL was reached. The mixture was subsequently added to a low-adhesion 96-well plate (Corning) at a volume of 100 μL per well. After incubating for 36–48 h at 37°C, the whole HTR8 cell suspension in the 96-well plate was filtered through cell filters with pore sizes of 100 μm and 70 μm. The inverted 70 μm cell filters were washed with decidualized culture medium (DMEM/F12 containing 2% FBS + 10 nM E2 + 100 nM MPA+500 μM cAMP), and 70–100 μm HTR8 cell spheres were placed on the filter. The above filtrate was cultured into decidualized ESCs, whereas the total number of HTR8 cell spheres was counted under a microscope. After 5 h, the cells were gently washed twice with PBS to remove the nonadherent HTR8 cell spheres, and the number of adherent HTR8 cell spheres was counted under a microscope. The adhesion rate (%) of HTR8 cell spheres was calculated as follows: (number of adherent HTR8 cell spheres/number of total HTR8 cell spheres) × 100%.
Immunofluorescence
The cells were fixed with 4% paraformaldehyde for 10 min, permeabilized with Triton X-100 (Out of the Box; Beyotime, Beijing, China) for 15 min, blocked in 1% BSA (Beyotime) for 1 h, incubated overnight at 4°C with an anti-vimentin antibody (1:200; Boster, Wuhan, China), and then incubated for 1 h with goat Cy3-conjugated anti-mouse IgG (1:500; PINUOFEI, China) and phalloidin (MedChemExpress). After a 10 min incubation with DAPI (2 μg/mL, Servicebio) and treatment with antifade mounting medium (Beyotime), the cells were examined using a fluorescence microscope.
Statistical analysis
Each experiment was independently repeated at least three times, and the data were analyzed using GraphPad Prism 8.0 software. Statistical comparisons between the two groups were performed using the unpaired Student’s t-test or Mann‒Whitney U test after assessment data normality. Comparisons of continuous variables among groups were conducted using one-way ANOVA followed by least significant difference tests. The results are presented as the mean ± s.d.P < 0.05 was considered to indicate statistical significance.
Results
MET is involved in the decidualization of endometrial stromal cells
Previous studies have shown that the cellular morphology changes observed during decidualization are consistent with the process of MET and are regulated by ovarian hormones (Ramathal et al. 2010). To investigate the involvement of MET in the decidualization of ESCs, primary NESCs were cultured and induced to undergo decidualization using an in vitro protocol. The abundance of prolactin (PRL) and insulin-like growth factor binding protein (IGFBP1) mRNA increased in a time-dependent manner following decidualization, with a significant increase observed at 4 days (Fig. 1A and B). The cytoskeletons of NESCs and NESCs that had been decidualized for 4 days in vitro were stained to observe the morphological changes during decidualization using immunofluorescence. Phalloidin staining revealed a transition in NESC morphology from elongated spindle-like cells to round-shaped cells after decidualization (Fig. 1C). The results demonstrated that NESCs underwent a transition from long spindle-shaped cells to round-like cells after decidualization induction. Western blot analysis revealed that E-cadherin protein abundance increased after 2 days of decidualization, and further increased after 4 days. Additionally, vimentin and Slug protein abundance decreased after 2 days of decidualization and further decreased after 4 days (Fig. 1D). Collectively, these findings suggest parallel increases in both PRL and IGFBP1 expression along with the observed morphologic MET during decidualization.
MET formation is related to decidualization in endometrial stromal cells. (A–D) NESCs were induced by a decidualization in vitro. (A, B) mRNA levels of PRL and IGFBP1 were examined by qRT-PCR. (C) Cytoskeleton staining to determine the cellular morphology of NESCs. (D) Representative Western blot analysis showing the levels of E-cadherin, vimentin, and Slug. Data presented are from three independent experiments (*P < 0.05, *** P < 0.001 compared to the day 0 group, n = 6).
Citation: Reproduction 168, 3; 10.1530/REP-23-0336
Repression of MET results in impaired decidualization in patients with endometriosis
IHC analysis was performed to examine the expression of MET markers in the secretory endometrium of healthy women (NC) and in the secretory eutopic endometrium of patients with endometriosis (EU) (Fig. 2A). The H-scores for these markers are summarized in Fig. 2B and D. Compared with that in the NC group, E-cadherin expression was detected in both epithelial and stromal cells in the NC group. In contrast, E-cadherin expression was detected only in epithelial cells and was decreased in stromal cells in the EU group. Vimentin and Slug were expressed in both epithelial and stromal cells, and significantly greater levels were detected in the EU group than in the NC group.
Impaired MET formation is related to decidualization failure in endometriosis. (A) Representative photomicrographs of E-cadherin, vimentin, and Slug expression in normal control endometrium (NC) and eutopic endometrium of endometriosis (EU). (B–D) IHC scores of E-cadherin, vimentin, and Slug in NC and EU. (E–J) NESCs and EESCs were induced by a decidualization protocol in vitro. (E and D) mRNA levels of PRL and IGFBP1 were examined by qRT-PCR. (G) Representative Western blot analysis showing the levels of E-cadherin, vimentin, and Slug. Data presented are from three independent experiments (# P < 0.05, ## P < 0.01 compared to the normal control group; *P < 0.05 compared to the NESCs group; IHC: NC = 14, EU = 13; Cell experiments: n = 4).
Citation: Reproduction 168, 3; 10.1530/REP-23-0336
NESCs and EESCs were separately induced for decidualization. The qRT-PCR results revealed that PRL and IGFBP1 mRNA abundance decreased in EESCs compared to that in NESCs (Fig. 2E and F). Western blot analysis demonstrated that the E-cadherin protein abundance decreased in EESCs compared to that in NESCs, whereas vimentin and Slug protein abundance both increased (Fig. 2G). Taken together, these findings indicate that impaired MET contributes to the failure of decidualization in the endometriotic secretory endometrium, primarily through the downregulation of E-cadherin and upregulation of vimentin and Slug.
Upregulation of METTL3-mediated m6A modification in the eutopic endometrium in the secretory phase in endometriosis
Secretory endometrium samples were collected from healthy women (normal) and patients with endometriosis (eutopic). The m6A levels in the normal and eutopic groups were quantified using a colorimetric method. The results revealed that the m6A levels were significantly greater in the eutopic group than in the normal group (Fig. 3A). Subsequently, m6A dot blot assays were performed on poly(A)+RNAs extracted from NESCs and EESCs, following an in vitro decidualization protocol. These assays demonstrated increased m6A levels in EESCs compared to those in NESCs (Fig. 3B). Methyltransferase-like 3 (METTL3), known as an m6A methyltransferase writer in mammalian cells given its involvement in m6A formation (Liu et al. 2014), was analyzed in the secretory endometrium of healthy women (NC) and in the secretory eutopic endometrium of patients with endometriosis (EU) using IHC. Representative IHC results are shown in Fig. 3C, and the H-scores of the NC and EU markers are summarized in Fig. 3D. Similarly, METTL3 expression was significantly upregulated in stromal cells in the EU group compared to those in the NC group. Additionally, western blot analysis revealed a substantial increase in METTL3 protein abundance in EESCs compared to that in NESCs (Fig. 3E).
Upregulation of METTL3-mediated m6A modification in the secretory phase eutopic endometrium of endometriosis. (A) M6A levels in NC and EU. (B) Dot blot assays were used to detect the m6A changes in NESCs and EESCs, which were induced by a decidualization protocol in vitro. (C) Representative photomicrographs of METTL3 expression in NC and EU. (D) IHC scores of METTL3 in NC and EU. (E) Western blot analysis showing the levels of METTL3 in NESCs and EESCs, which were induced by a decidualization protocol in vitro. Data presented are from three independent experiments (# P < 0.05 compared to the normal control group; *P < 0.05 compared to the NESC group; IHC: NC = 14, EU = 13; cell experiments: n = 4).
Citation: Reproduction 168, 3; 10.1530/REP-23-0336
Augmented METTL3 expression impairs MET, leading to decidualization failure in endometriosis
To determine the involvement of METTL3 in the decidualization of ESCs, NESCs were cultured and induced using a decidualization protocol in vitro. The METTL3 protein abundance decreased after 2 days of decidualization and further decreased after 4 days (Fig. 4A). IHESCs exhibit the same phenotype as primary ESCs under the control of a decidualization protocol (Supplementary File 3). To investigate the relationship between METTL3 and MET in endometrial receptivity, IHESCs were transfected with MELLT3 siRNA or an overexpression plasmid for 24 h and then induced using a decidualization protocol for another 4 days. METTL3 mRNA abundance decreased, and PRL and IGFBP1 mRNA abundance increased in IHESCs in response to the decidualization protocol (Fig. 4B). Moreover, the E-cadherin protein abundance increased in cells transfected with si-METTL3 compared to those transfected with si-NC, whereas vimentin and Slug protein abundance both decreased (Fig. 4C). Subsequently, IHESCs were transfected with a METTL3 plasmid or vector for 24 h and then incubated with the decidualization protocol for 4 days. Similarly, the increased abundance of METTL3 mRNA and decreased abundance of PRL and IGFBP1 mRNA were attributed to the decidualization protocol used in IHESCs (Fig. 4D). E-cadherin protein abundance decreased in cells transfected with the METTL3 plasmid compared to that in vector-transfected cells, whereas vimentin and Slug proteins abundance both increased (Fig. 4E). Functional analysis using spheroid adhesion assays on both in vitro models revealed that METTL3 overexpression significantly impaired stromal cell adhesion to HTR8/SVneo spheroids (Fig. 4F). These results demonstrate that METTL3-mediated m6A modification inhibits MET and contributes to the failure of endometrial decidualization during the secretory phase of endometriosis.
Augmented METTL3 induced impaired MET which leads to decidualization failure in endometriosis. (A) NESCs were induced by a decidualization protocol for 2 or 4 days in vitro. The expression of METTL3 was examined by western blot analysis. (B, C) IHESCs were transfected with si-METTL3 or si-NC and then induced by decidualization protocol in vitro for 4 days. (B) mRNA levels of METTL3, PRL, and IGFBP1 were examined by qRT-PCR in IHESCs. (C) Representative Western blot analysis showing the levels of METTL3, E-cadherin and vimentin, and Slug in IHESCs. (D, E) IHESCs were transfected with METTL3 plasmid or vector and then induced by decidualization protocol for 4 days in vitro. (D) mRNA levels of METTL3, PRL, and IGFBP1 were examined by qRT-PCR in IHESCs. (E) Representative Western blot analysis showing the levels of METTL3, E-cadherin and vimentin, and Slug in IHESCs. (H) Representative images and adhesion rare were presented to show adhered HTR8 spheroids attached spheroids in IHESCs. Data presented are from three independent experiments (*P < 0.05 compared to the day 0 group; #P < 0.05, ##P < 0.01, ###P < 0.001, ####P < 0.0001 compared to the si-NC or vector group; n = 6).
Citation: Reproduction 168, 3; 10.1530/REP-23-0336
Discussion
In this study, our findings demonstrate that METTL3-mediated m6A modification impairs the decidualization of ESCs by hindering MET formation in the eutopic endometrium in patients with endometriosis, thus affecting endometrial receptivity and resulting in endometriosis-related infertility. The main findings were as follows: (i) increased mesenchymal marker expression, decreased epithelial marker expression, and decreased decidual marker expression were observed in the stromal cells of eutopic endometriosis, resulting in infertility due to MET and decidualization defects; and (ii) high levels of m6A and METTL3 expression were also correlated with aberrant MET and defective decidualization in the stromal cells of eutopic endometriosis. We provide evidence demonstrating a positive correlation between elevated m6A levels and impaired MET as well as disrupted decidualization in the eutopic endometrium in patients with endometriosis.
The human endometrium contains two structural layers: the upper functional layer and the underlying basalis layer. The functional layer contains multiple cell types, such as ESCs, luminal epithelium, and glandular epithelium, which play crucial roles in cyclic regeneration, differentiation, and decidualization. Decidualization is a substantial differentiation process in the uterine endometrium that prepares for pregnancy. MET is a process in which mesenchymal cells lose their mesenchymal characteristics while gaining epithelial characteristics, and the process is associated with distinct cellular markers (Gonzalez & Medici 2014, Lamouille et al. 2014, Nieto et al. 2016). Previous studies have demonstrated the pivotal role of MET in normal physiological functions in the endometrium (Owusu-Akyaw et al. 2019). MET plays an important role in the decidualization of ESCs and is needed for successful implantation and pregnancy. Primary NESCs, isolated from endometrial biopsy tissue samples from healthy reproductive-age women, were incubated with estradiol (E2), progesterone (P4), and cAMP to simulate decidualization in vitro. Our findings demonstrated that the mRNA expression of PRL and IGFBP-1, key proteins expressed in decidualized stromal cells, increased under the influence of decidualization in vitro. Additionally, an increase in the expression of E-cadherin, a recognized marker of epithelial cells, was observed. However, the expression of markers of mesenchymal cells, such as vimentin, and EMT-related transcription factors, such as Slug, increased in a manner consistent with the phenotypic change from mesenchymal to epithelioid morphology. These in vitro findings provide further evidence supporting the occurrence of MET during decidualization.
Endometriosis is a chronic disease characterized by pelvic pain and defined as the presence of endometrial-like tissue outside the uterus. The prevalence of pregnancy in women with endometriosis ranges from 6% to 10%. Although the association between endometriosis and infertility is well-established, its etiology remains unclear. Previous studies have demonstrated that reduced endometrial receptivity contributes to impaired fertility in individuals with endometriosis (Lessey & Kim 2017). The decidua is an important component of the maternal–embryo interface that provides nutrients to the embryo, protects the developing embryo from stress and immune rejection, and regulates trophoblast invasion. Therefore, aberrant decidualization may have adverse effects on embryo implantation and pregnancy. Moreover, women with endometriosis exhibit defects in decidualization in their eutopic endometrium (Xunqin et al. 2012), which alters endometrial receptivity and reduces fertility. Impaired decidualization has been reported in eutopic tissues of patients with endometriosis (Aghajanova et al. 2009, Klemmt et al. 2006). Our previous research demonstrated the significant role of EMT in the development of ovarian endometriosis within the ectopic endometrium (Xiong et al. 2019). MET and EMT are fundamental cellular processes involved in the transition between epithelial and mesenchymal phenotypes and play crucial roles in various diseases. Based on the above research, we collected secretory endometrium samples from both healthy women and those with endometriosis separately. Our results revealed a decrease in the epithelial marker E-cadherin, an increase in the mesenchymal marker vimentin, and an increase in Slug, a well-established gene that regulates both the EMT and MET, in stromal cells of the eutopic endometrium in the endometriosis secretory phase. Furthermore, our in vitro experiments demonstrated that, compared with NESCs, EESCs exhibit lower PRL and IGFBP1 expression, and this change is accompanied by impaired formation of MET. These alterations contribute to the characteristic changes observed in the eutopic endometrium associated with infertility related to endometriosis.
Previous studies have revealed that METTL3-mediated m6A modification plays a significant role in the pathogenesis of endometriosis (Li et al. 2021, 2023). In our previous research, we observed a decrease in both the m6A level and METTL3 expression in the proliferative phase eutopic endometrium of endometriosis patients compared to controls, indicating that decreased METTL3 promotes the migration and invasion of HESCs, contributing to the development of endometriosis (Li et al. 2021). However, previous studies have focused on the significance of m6A and its regulators in the pathogenesis of endometriosis, and studies on the relationship between m6A and endometriosis-associated infertility are rare. In this study, increases in both the m6A level and METTL3 expression were observed in the secretory phase eutopic endometria of endometriosis patients compared to those of controls. Furthermore, using an in vitro decidualization protocol, our results provide evidence supporting the crucial role of decreased METTL3 expression in normal stromal cell decidualization. We hypothesized that increased m6A levels and METTL3 expression may be positively associated with defects in decidualization within the eutopic endometrium affected by endometriosis. To validate this hypothesis, stromal cells extracted from individuals with endometriosis (ESCs) and normal controls (NSCs) were subjected to an in vitro decidualization protocol. M6A and METTL3 expression was greater in ESCs after induction than in NSCs following induction. To further elucidate how impaired decidualization is caused by altered METTL3 function, IHESCs were transfected with METTL3 siRNA or an overexpression plasmid prior to undergoing an in vitro decidualization protocol. Knockdown of METTL3 in IHESCs positively influenced PRL and IGFBP1 expression and enhanced MET formation, which was decreased upon METTL3 overexpression. Increased m6A levels and elevated METTL3 expression resulted in attenuated MET in EESCs, which hindered decidualization during the secretory phase and disrupted endometrial receptivity. Collectively, our findings suggest that high METTL3 expression mediates m6A modification, leading to reduced MET formation in the secretory phase of the eutopic endometrium.
Slug, an EMT transcription factor, inhibits E-cadherin expression and mediates the transition between EMT and MET. The present study revealed an increase in slug expression in the eutopic endometrium of patients with endometriosis in the secretory phase compared to that in the eutopic endometrium of controls. Conversely, a decrease in slug expression was detected along with increased PRL and IGFBP expression in vitro. Therefore, we conclude that slug acts as a negative regulator of decidualization. Additionally, both endometrial tissue and in vitro cell experiments demonstrated a positive correlation between slug and METTL3 expression. Previous studies identified a m6A site within the coding DNA sequence (CDS) region of Slug mRNA that is recognized by m6A-mediated stabilization of slug mRNA (Yu et al. 2022). Based on these findings, we hypothesize that METTL3 recognizes and binds to the m6A site within the CDS region of Slug mRNA to stabilize its expression. However, further experimental verification is needed to determine the specific interaction between METTL3 and the m6A site on slug mRNA, which represents a limitation of our study.
Early studies on donor oocytes from the same donor in women with or without endometriosis have suggested that defective implantation is likely involved in endometriosis-related infertility (Prapas et al. 2012). Animal studies also support these clinical findings, suggesting that alterations in the eutopic endometrium contribute to implantation defects associated with endometriosis (Braundmeier et al. 2012, Illera et al. 2000). Defective decidualization of the eutopic endometrium plays an important role in endometriosis-related infertility (Yin et al. 2012). Increased expression of mesenchymal markers and decreased expression of epithelial markers, along with aberrant expression of decidualization markers, were observed in the stromal cells of the normal endometrium affected by endometriosis. These changes result in impaired MET and defective decidualization, ultimately leading to infertility. Additionally, elevated m6A modification and increased METTL3 expression are correlated with abnormal MET and defective decidualization in stromal cells affected by ectopic endometrial tissue. Based on these observations, we propose that increased METTL3-mediated m6A modification plays a significant role in attenuating MET and impairing the decidualization of EESCs, thereby contributing to reduced receptivity during the development of endometriosis.
Supplementary materials
This is linked to the online version of the paper at https://doi.org/10.1530/REP-23-0336.
Declaration of interest
The authors declare that there are no conflicts of interest that could be perceived as prejudicing the impartiality of the study reported.
Funding
This project was supported by the National Natural Science Foundation of China (grant number 82071722 to Wenqian Xiong, 2020) and the Natural Science Foundation of Hubei Province of China (grant number 2020CFB834 to Wenqian Xiong, 2020).
Author contribution statement
YL conceived and designed the experiments. JJ executed the experiments and analyzed the data. WX wrote the manuscript, and all the other authors contributed to the manuscript.
References
Aghajanova L, Hamilton A, Kwintkiewicz J, Vo KC & & Giudice LC 2009 Steroidogenic enzyme and key decidualization marker dysregulation in endometrial stromal cells from women with versus without endometriosis. Biology of Reproduction 80 105–114. (https://doi.org/10.1095/biolreprod.108.070300)
Bakir B, Chiarella AM, Pitarresi JR & & Rustgi AK 2020 EMT, MET, plasticity, and tumor metastasis. Trends in Cell Biology 30 764–776. (https://doi.org/10.1016/j.tcb.2020.07.003)
Bonavina G & & Taylor HS 2022 Endometriosis-associated infertility: from pathophysiology to tailored treatment. Frontiers in Endocrinology 13 1020827. (https://doi.org/10.3389/fendo.2022.1020827)
Braundmeier A, Jackson K, Hastings J, Koehler J, Nowak R & & Fazleabas A 2012 Induction of endometriosis alters the peripheral and endometrial regulatory T cell population in the non-human primate. Human Reproduction 27 1712–1722. (https://doi.org/10.1093/humrep/des083)
Chen T, You Y, Jiang H & & Wang ZZ 2017 Epithelial-mesenchymal transition (EMT): a biological process in the development, stem cell differentiation, and tumorigenesis. Journal of Cellular Physiology 232 3261–3272. (https://doi.org/10.1002/jcp.25797)
Chen XY, Zhang J & & Zhu JS 2019 The role of m(6)A RNA methylation in human cancer. Molecular Cancer 18 103. (https://doi.org/10.1186/s12943-019-1033-z)
Chen Y, Lin Y, Shu Y, He J & & Gao W 2020 Interaction between N(6)-methyladenosine (m(6)A) modification and noncoding RNAs in cancer. Molecular Cancer 19 94. (https://doi.org/10.1186/s12943-020-01207-4)
Chen J, Fang Y, Xu Y & & Sun H 2022 Role of m6A modification in female infertility and reproductive system diseases. International Journal of Biological Sciences 18 3592–3604. (https://doi.org/10.7150/ijbs.69771)
Dharmaraj N, Chapela PJ, Morgado M, Hawkins SM, Lessey BA, Young SL & & Carson DD 2014 Expression of the transmembrane mucins, MUC1, MUC4 and MUC16, in normal endometrium and in endometriosis. Human Reproduction 29 1730–1738. (https://doi.org/10.1093/humrep/deu146)
Dongre A & & Weinberg RA 2019 New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nature Reviews 20 69–84. (https://doi.org/10.1038/s41580-018-0080-4)
Giudice LC 2010 Clinical practice. Endometriosis. New England Journal of Medicine 362 2389–2398. (https://doi.org/10.1056/NEJMcp1000274)
Gonzalez DM & & Medici D 2014 Signaling mechanisms of the epithelial-mesenchymal transition. Science Signaling 7 re8. (https://doi.org/10.1126/scisignal.2005189)
Heuberger J & & Birchmeier W 2010 Interplay of cadherin-mediated cell adhesion and canonical Wnt signaling. Cold Spring Harbor Perspectives in Biology 2 a002915. (https://doi.org/10.1101/cshperspect.a002915)
Huang W, Chen TQ, Fang K, Zeng ZC, Ye H & & Chen YQ 2021 N6-methyladenosine methyltransferases: functions, regulation, and clinical potential. Journal of Hematology and Oncology 14 117. (https://doi.org/10.1186/s13045-021-01129-8)
Illera MJ, Juan L, Stewart CL, Cullinan E, Ruman J & & Lessey BA 2000 Effect of peritoneal fluid from women with endometriosis on implantation in the mouse model. Fertility and Sterility 74 41–48. (https://doi.org/10.1016/s0015-0282(0000552-5)
Jolly MK, Ware KE, Gilja S, Somarelli JA & & Levine H 2017 EMT and MET: necessary or permissive for metastasis? Molecular Oncology 11 755–769. (https://doi.org/10.1002/1878-0261.12083)
Klemmt PA, Carver JG, Kennedy SH, Koninckx PR & & Mardon HJ 2006 Stromal cells from endometriotic lesions and endometrium from women with endometriosis have reduced decidualization capacity. Fertility and Sterility 85 564–572. (https://doi.org/10.1016/j.fertnstert.2005.08.046)
Lamouille S, Xu J & & Derynck R 2014 Molecular mechanisms of epithelial-mesenchymal transition. Nature Reviews 15 178–196. (https://doi.org/10.1038/nrm3758)
Lee YH, Tan CW, Venkatratnam A, Tan CS, Cui L, Loh SF, Griffith L, Tannenbaum SR & & Chan JK 2014 Dysregulated sphingolipid metabolism in endometriosis. Journal of Clinical Endocrinology and Metabolism 99 E1913–E1921. (https://doi.org/10.1210/jc.2014-1340)
Lessey BA & & Kim JJ 2017 Endometrial receptivity in the eutopic endometrium of women with endometriosis: it is affected, and let me show you why. Fertility and Sterility 108 19–27. (https://doi.org/10.1016/j.fertnstert.2017.05.031)
Li X, Xiong W, Long X, Dai X, Peng Y, Xu Y, Zhang Z, Zhang L & & Liu Y 2021 Inhibition of METTL3/m6A/miR126 promotes the migration and invasion of endometrial stromal cells in endometriosisdagger. Biology of Reproduction 105 1221–1233. (https://doi.org/10.1093/biolre/ioab152)
Li Q, Yang L, Zhang F, Liu J, Jiang M, Chen Y & & Ren C 2023 m6A methyltransferase METTL3 inhibits endometriosis by regulating alternative splicing of MIR17HG. Reproduction 165 197–208. (https://doi.org/10.1530/REP-22-0102)
Lin X, Chai G, Wu Y, Li J, Chen F, Liu J, Luo G, Tauler J, Du J, Lin S, et al.2019 RNA m(6)A methylation regulates the epithelial mesenchymal transition of cancer cells and translation of Snail. Nature Communications 10 2065. (https://doi.org/10.1038/s41467-019-09865-9)
Lin H, Wang Y, Wang P, Long F & & Wang T 2022 Mutual regulation between N6-methyladenosine (m6A) modification and circular RNAs in cancer: impacts on therapeutic resistance. Molecular Cancer 21 148. (https://doi.org/10.1186/s12943-022-01620-x)
Liu H & & Lang JH 2011 Is abnormal eutopic endometrium the cause of endometriosis? The role of eutopic endometrium in pathogenesis of endometriosis. Medical Science Monitor 17 RA92–RA99. (https://doi.org/10.12659/msm.881707)
Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, et al.2014 A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nature Chemical Biology 10 93–95. (https://doi.org/10.1038/nchembio.1432)
Minici F, Tiberi F, Tropea A, Orlando M, Gangale MF, Romani F, Campo S, Bompiani A, Lanzone A & & Apa R 2008 Endometriosis and human infertility: a new investigation into the role of eutopic endometrium. Human Reproduction 23 530–537. (https://doi.org/10.1093/humrep/dem399)
Nieto MA, Huang RY, Jackson RA & & Thiery JP 2016 Emt: 2016. Cell 166 21–45. (https://doi.org/10.1016/j.cell.2016.06.028)
Owusu-Akyaw A, Krishnamoorthy K, Goldsmith LT & & Morelli SS 2019 The role of mesenchymal-epithelial transition in endometrial function. Human Reproduction Update 25 114–133. (https://doi.org/10.1093/humupd/dmy035)
Prapas Y, Goudakou M, Matalliotakis I, Kalogeraki A, Matalliotaki C, Panagiotidis Y, Ravanos K & & Prapas N 2012 History of endometriosis may adversely affect the outcome in menopausal recipients of sibling oocytes. Reproductive Biomedicine Online 25 543–548. (https://doi.org/10.1016/j.rbmo.2012.07.020)
Ramathal CY, Bagchi IC, Taylor RN & & Bagchi MK 2010 Endometrial decidualization: of mice and men. Seminars in Reproductive Medicine 28 17–26. (https://doi.org/10.1055/s-0029-1242989)
Remmele W & & Schicketanz KH 1993 Immunohistochemical determination of estrogen and progesterone receptor content in human breast cancer. Computer-assisted image analysis (QIC score) vs. subjective grading (IRS). Pathology, Research and Practice 189 862–866. (https://doi.org/10.1016/S0344-0338(1181095-2)
Tanbo T & & Fedorcsak P 2017 Endometriosis-associated infertility: aspects of pathophysiological mechanisms and treatment options. Acta Obstetricia et Gynecologica Scandinavica 96 659–667. (https://doi.org/10.1111/aogs.13082)
Xiong W, Zhang L, Xiong Y, Liu H & & Liu Y 2016 Hypoxia Promotes Invasion of Endometrial stromal cells via hypoxia-inducible factor 1alpha upregulation-mediated beta-catenin activation in endometriosis. Reproductive Sciences 23 531–541. (https://doi.org/10.1177/1933719115607999)
Xiong W, Zhang L, Liu H, Li N, Du Y, He H, Zhang Z & & Liu Y 2019 E2-mediated EMT by activation of β-catenin/Snail signalling during the development of ovarian endometriosis. Journal of Cellular and Molecular Medicine 23 8035–8045. (https://doi.org/10.1111/jcmm.14668)
Xunqin Y, Pavone ME, Lu Z, Wei J & & Kim JJ 2012 Increased activation of the PI3K/AKT pathway compromises decidualization of stromal cells from endometriosis. Journal of Clinical Endocrinology and Metabolism 97 E35–E43. (https://doi.org/10.1210/jc.2011-1527)
Yin X, Pavone ME, Lu Z, Wei J & & Kim JJ 2012 Increased activation of the PI3K/AKT pathway compromises decidualization of stromal cells from endometriosis. Journal of Clinical Endocrinology and Metabolism 97 E35–43. (https://doi.org/10.1210/jc.2011-1527)
Yu L, Hu R, Sullivan C, Swanson RJ, Oehninger S, Sun YP & & Bocca S 2016 MFGE8 regulates TGF-beta-induced epithelial mesenchymal transition in endometrial epithelial cells in vitro. Reproduction 152 225–233. (https://doi.org/10.1530/REP-15-0585)
Yu D, Pan M, Li Y, Lu T, Wang Z, Liu C & & Hu G 2022 RNA N6-methyladenosine reader IGF2BP2 promotes lymphatic metastasis and epithelial-mesenchymal transition of head and neck squamous carcinoma cells via stabilizing slug mRNA in an m6A-dependent manner. Journal of Experimental and Clinical Cancer Research 41 6. (https://doi.org/10.1186/s13046-021-02212-1)
Yue B, Song C, Yang L, Cui R, Cheng X, Zhang Z & & Zhao G 2019 METTL3-mediated N6-methyladenosine modification is critical for epithelial-mesenchymal transition and metastasis of gastric cancer. Molecular Cancer 18 142. (https://doi.org/10.1186/s12943-019-1065-4)
Zhang L, Patterson AL, Zhang L, Teixeira JM & & Pru JK 2012 Endometrial stromal beta-catenin is required for steroid-dependent mesenchymal-epithelial cross talk and decidualization. Reproductive Biology and Endocrinology 10 75. (https://doi.org/10.1186/1477-7827-10-75)
Zhao S, Zhang B, Yuan H, Yin Y, Qi S, Li W, Wu X & & Yaling F 2022 IGF2BP2 promotes the progression of ovarian endometriosis by regulating m6A-modified MEIS2 and GATA6. International Journal of Biochemistry and Cell Biology 152 106296. (https://doi.org/10.1016/j.biocel.2022.106296)
