Abstract
In brief
Bovine embryos lacking SMC2 (a core component of condensins I and II) are unable to survive maternal recognition of pregnancy. SMC2 KO embryos are able to form blastocysts, exhibiting a reduced cell proliferation ability, and arrest their development shortly after hatching.
Abstract
Condensins are large protein complexes required for chromosome assembly and segregation during mitosis and meiosis. Mouse or bovine embryos lacking SMC2 (a core component of condensins I and II) do not complete development to term, but it is unknown when they arrest their development. Herein, we have assessed the developmental ability of bovine embryos lacking SMC2 due to a naturally occurring mutation termed HH3 (Holstein Haplotype 3) or by CRISPR-mediated gene ablation. To determine if embryos homozygous for the HH3 allele survive to maternal recognition of pregnancy, embryonic day (E)14 embryos were flushed from superovulated carrier cows inseminated with a carrier bull. Mendelian inheritance of the HH3 allele was observed at E14 conceptuses but conceptuses homozygous for HH3 failed to achieve elongation and lacked an embryonic disc. To assess the consequence of the ablation of condensins I and II at earlier developmental stages, SMC2 KO bovine embryos were generated in vitro using CRISPR technology. SMC2 KO embryos were able to form blastocysts but exhibited reduced cell proliferation as evidenced by a significantly lower number of total, trophectoderm (CDX2+), and inner cell mass (SOX2+) cells at Day (D) 8 post-fertilization compared to their WT counterparts and were unable to survive to D12 in vitro. SMC2 ablation did not alter relative telomere length at D8, D12, or E14. In conclusion, condensins I and II are required for blastomere mitosis during early development, and embryos lacking those complexes arrest their development shortly after blastocyst hatching.
Introduction
Genotyping programs pursuing the genetic improvement of cattle breeds have uncovered multiple haplotypes (alleles) involved in cattle reproductive performance, including several deleterious haplotypes which are never found in homozygosity at birth (VanRaden et al. 2011). Homozygous embryos for a deleterious haplotype—termed double-carriers (DC) – arrest their development at some point between conception and birth, thereby providing information on the essential role of a gene during embryonic or fetal development (Perez-Gomez et al. 2024a). Holstein Haplotype 3 (HH3) is a deleterious allele present in ~5% of Holstein Friesian cattle (VanRaden et al. 2011) that is composed of a non synonymous SNP (T/C) within exon 24 of the structural maintenance of chromosomes 2 (SMC2) gene, which substitutes amino acid 1135 from phenylalanine (TTC) to serine (TCC) within the NTPase domain of SMC2 (Daetwyler et al. 2014; McClure et al. 2014). SMC2 protein is a core subunit of condensins I and II (Stray et al. 2005), large protein complexes required for chromosome assembly and segregation during mitosis and meiosis (Hirano 2016), and its essential role in embryo/fetal development is conserved in mammals, as Smc2 KO mouse embryos do not survive to term (Nishide & Hirano 2014).
The developmental stage at which mammalian embryos lacking both condensin complexes (I and II) arrest their development is currently unknown, as the developmental potential of SMC2 KO embryos has not been precisely determined and no study has been conducted on embryos lacking the other core component of condensins I and II (SMC4). Embryo mortality in HH3 DC bovine embryos (SMC2 KO) has been estimated to occur before the second month of gestation according to the reproductive performance data available from cattle genotyping programs (McClure et al. 2014). Unfortunately, such data do not allow for the identification of when HH3 double-carrier (SMC2-null) embryos arrest their development within the first 2 months of gestation. Prior experimentation in mice has not addressed that question, as the earliest time point analyzed was E12.5 (Nishide & Hirano 2014), a fetal stage not reached by bovine embryos by the second month of gestation (Krog et al. 2018; Theiler 1989), when no Smc2 KO mouse fetuses were recovered.
From conception to the second month of gestation, the cattle embryo transits through critical developmental stages (Perez-Gomez et al. 2021). The initially undifferentiated blastomeres differentiate into inner cell mass and trophectoderm cells, leading to the formation of a blastocyst around embryonic day 7 (E7). Following blastocyst expansion, the embryo hatches from the zona pellucida (~E9) and the inner cell mass differentiates into the epiblast—which will form the embryo proper—and the hypoblast—which will form the extra-embryonic membranes together with the trophectoderm. After hatching, hypoblast proliferates to form an inner layer beneath the trophectoderm by E11 (Maddox-Hyttel et al. 2003) and both extra-embryonic membranes experience massive growth required to signal pregnancy to the uterus and prevent luteolysis by E15–16 (Forde et al. 2011; Northey & French 1980). Meanwhile, the epiblast develops an embryonic disc where gastrulation starts around E14–15 (van Leeuwen et al. 2015) and leads to the differentiation of the three germ layers (ectoderm, mesoderm, and endoderm) prior to implantation (E19–20 (Bazer et al. 2009)). Following implantation, several critical structures identifiable by ultrasonography – such as the spinal cord, forelimbs, hindlimbs, optic lens, and ribs – are formed before E60 (Curran et al. 1986). To test the hypothesis of condensins being required for mammalian preimplantation development, this study has determined which of these developmental stages can be reached by mammalian embryos lacking condensins I and II (SMC2 KO) by conducting in vivo experimentation with HH3 single-carrier (SC) animals and in vitro experimentation with SMC2 KO bovine embryos generated by CRISPR.
Materials and methods
In vivo conceptus collection
Cattle embryos were collected at a commercial cattle farm following conventional protocols employed for reproductive management (Ramos-Ibeas et al. 2020), involving a superovulation protocol detailed in (Fig. 1A) and approved by Madrid Region Authorities (PROEX 040/17). Four stimulated HH3 carrier cows were inseminated with semen from a carrier bull of proven fertility, and embryos were collected from the uterus 14.5 days after the first insemination (E14) by non-surgical flushing using a Luer catheter. Immediately after collection, embryos were fixed in 4% paraformaldehyde (PFA) for 15 min at room temperature (RT), washed, and stored in PBS supplemented with 1% bovine serum albumin (PBS-1% BSA) at 4°C until analysis.
Conceptus elongation is impaired in HH3 double-carrier (DC) conceptuses. A) Superovulation protocol to obtain in vivo elongated conceptuses. AI, Artificial Insemination; E, Embryonic day. B) Immunohistochemistry to detect SOX2 (epiblast) and SOX17 (hypoblast); cell nuclei counterstained with DAPI. Representative pictures of tubular NC and HH3 SC conceptuses, and the two HH3 DC embryos obtained at E14. Scale bar: 100 µm for conceptuses; 50 µm for embryonic disc magnifications. C) Representative Sanger sequencing chromatograms from PCR products of conceptuses recovered from a cross of SC individuals. The image on the left corresponds to an NC conceptus (displaying TTC codon), the middle image depicts an SC conceptus (carrying both TTC and TCC –HH3- alleles), and the image on the right shows a DC conceptus (harboring the TCC codon –HH3 allele- in both chromosomes).
Citation: Reproduction 168, 5; 10.1530/REP-24-0211
Generation of CRISPR components for oocyte microinjection
Capped polyadenylated Cas9 messenger RNA (mRNA) was in vitro transcribed by the mMESSAGE mMACHINE T7 ULTRA kit® (Life Technologies) using the plasmid pMJ920 (Addgene 42234) linearized with BbsI and treated with Antarctic phosphatase (NEB) and purified using the MEGAClear kit (Life Technologies) (Bermejo-Alvarez et al. 2015). Single guide RNA (sgRNA) against the 24th exon of SMC2 (the exon containing HH3 SNP) was designed using CRISPOR (Concordet & Haeussler 2018) and synthesized and purified using the Guide-it sgRNA In Vitro Transcription Kit® (Takara) using a primer containing the T7 promoter and the sgRNA sequence (Table 1). Genome edition and KO generation rates were assessed by genotyping all embryos developing into blastocysts as described below.
Details of primers used. The target sequence in the CRISPR system is presented in bold and underlined.
| ID | Sequence (5′→3′) | Use | |
|---|---|---|---|
| Forward | Reverse | ||
| Geno | TCAGCGCTTTGGCAAAAAGT | AGCCTCTTTCCTTCTGGAACC | To genotype E14 conceptuses by Sanger |
| GenoIl | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGTAGCAGATTTGCTTCAGCG | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCTGAGGCTCTTTTTGGTTCT | To genotype D8/12 embryos, including Illumina overhangs (underlined) |
| Telq | CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT | GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT | To analyze relative telomere length |
| Sat216 | TGGAAGCAAAGAACCCCGCT | TCGTGAGAAACCGCACACTG | To analyze relative telomere length |
| T7 Guide-it | CCTCTAATACGACTCACTATA GGATGAGGTCGATGCAGCCC GTTTAAGAGCTATGC | To produce gRNA against SMC2, target sequence in bold and underlined. | |
In vitro production of SMC2 KO embryos
Genome-edited bovine embryos were produced in vitro following protocols previously described (Lamas-Toranzo et al. 2019). Briefly, immature cumulus-oocyte complexes (COCs) were obtained by aspirating 2–8 mm follicles from bovine ovaries collected at local slaughterhouses. COCs were selected based on conventional morphological criteria and matured for 24 h in groups of 50 in four-well dishes containing TCM-199 medium supplemented with 10% (v/v) fetal calf serum (FCS) and 10 ng/mL epidermal growth factor (EGF) at 38.5°C and 5% CO2 in the air with a humidified atmosphere. Matured oocytes were denuded by vortexing for 3 min in 1 mL of 300 µg/mL hyaluronidase and randomly divided into two groups for microinjection. One group was microinjected with a solution of Cas9 mRNA and sgRNA against SMC2 (C+G group) at a concentration of 300 and 100 ng/µL, respectively, and another with Cas9 alone at 300 ng/µL, serving as an injection control (C group). Cytoplasmic microinjection was performed on denuded oocytes using a filament needle under a Leica DMi8 inverted microscope assisted by Femptojet (Eppendorf).
Immediately following microinjection, IVF was carried out with frozen-thawed spermatozoa from a single stud bull selected through a gradient of 40–80% Bovipure (Nidacon Laboratories AB, Göthenborg, Sweden). Spermatozoa were co-incubated with 30–50 microinjected oocytes at a final concentration of 106 spermatozoa/mL in TALP medium supplemented with 10 mg/mL heparin, in four-well plates at 38.5°C in an atmosphere of 5% CO2 and maximum humidity. At approximately 20 h post-insemination (hpi), presumptive zygotes were vortexed for 30 sec to remove the spermatozoa attached to the zona pellucida and cultured in groups of 20–25 in 25 μL droplets of synthetic oviduct fluid (SOF), supplemented with 5% FCS under mineral oil. Culture took place at 38.5°C in an atmosphere of 5% CO2, 5% O2, and 90% N2 with maximum humidity. Cleavage and blastocyst rates were evaluated at 48 hpi and at D8 post-insemination, respectively. D8 blastocysts were fixed in 4% PFA during 15 min at RT and stored in PBS-1% BSA as described above.
Post-hatching culture was carried out following an optimized protocol described in (Ramos-Ibeas et al. 2023). Briefly, D7 blastocysts were cultured in 500 μL of N2B27 medium (1:1 Neurobasal and DMEM/F12 medium supplemented with 1x penicillin/streptomycin, 2 mM glutamine, 1x N2 and 1x B27 supplements; Thermo Fisher Scientific). Post-hatching culture took place at 38.5°C in a water-saturated atmosphere of 5% CO2, 5% O2, and 90% N2 and half of the culture medium was replaced every second day. Embryos remained in culture until D12, when embryo survival was analyzed (alive embryos were able to maintain the blastocoel, whereas dead embryos collapsed). Surviving embryos were fixed as described above.
Lineage development analysis by immunohistochemistry (IHC)
D8, D12, and E14 embryos fixed as described above, were washed in PBS-1% BSA and permeabilized in 1% Triton X-100 in PBS for 15 min at RT and blocked in 10% FCS-0.02 Tween 20 in PBS for 1 h at RT. Subsequently, specimens were incubated overnight at 4°C with primary antibodies to detect trophectoderm (CDX2, Biogenex MU392A-UC, 1:100 dilution), hypoblast (SOX17, R&D AF1924, 1:100 dilution), and epiblast (SOX2, Invitrogen 14-9811-80, 1:100 dilution) cells. After four washes in PBS-1% BSA, embryos were incubated in the appropriate secondary Alexa-conjugated antibodies (Donkey anti-rat IgG Alexa FluorTM 488, Donkey anti-goat IgG Alexa FluorTM 555, and Donkey anti-mouse IgG Alexa FluorTM 647; Life Technologies) and DAPI for 1 h at RT, followed by four washes in PBS-1% BSA. Finally, embryos were mounted on PBS-1% BSA microdrops made by drawing circles with a PAP pen (Kisker Biotech GmbH) on a coverslide (Bermejo-Alvarez et al. 2012). Microdrops were covered by an incubation chamber (Sigma Z359467) to prevent embryo crushing. Embryos were imaged at a structured illumination equipment composed of a Zeiss Axio Observer microscope coupled to ApoTome.2 (Zeiss). Following image acquisition, embryo diameter was measured to determine embryo size, and lineage development was analyzed. Total, CDX2+ and SOX2+ cell numbers were manually counted in D8 blastocysts using the ZEN software (Zeiss). In D12 embryos, complete hypoblast migration was determined when SOX17+ hypoblast cells expanded on the inner surface of the CDX2+ trophectoderm, and epiblast survival was identified by the presence of SOX2+ cells in the embryo, whereas ED-like formation was identified by the presence of a compact structure containing SOX2+ cells.
Embryo genotyping
Embryo genotyping was performed following fixation and image analysis by Sanger sequencing in all E14 conceptuses collected, generated by the cross of carrier individuals. To that aim, a fragment of each conceptus was dissected and placed at the bottom of a 0.2 mL PCR tube and stored at −20 ºC until analysis. Samples were digested with 15 µL of Arcturus Picopure DNA extraction solution (Thermo Fisher Scientific) following incubation at 65°C for 1 h and inactivation at 95°C for 10 min. PCR was performed using 4 µL of the lysate in a 50 µL PCR reaction (GoTaq Flexi, Promega) to amplify the fragment containing the SNP of HH3, employing the primers described in Table 1. PCR conditions were as follows: 94°C for 2 min; ×35 (94°C for 20 s, 60°C for 30 s, 72°C for 30 s); 72°C for 5 min; hold at 8°C. The PCR products were purified using the FavorPrepTM PCR Purification kit (Favorgen) and Sanger sequenced (Stabvida, Portugal) to identify non-carrier (NC, i.e. wild type, WT), single-carrier, and double-carrier embryos (Fig. 1C).
All D8 and D12 embryos generated following CRISPR-based genome editing in C+G group, were individually genotyped by Deep Sequencing (miSeq, Illumina) to identify all alleles harbored by each specimen (Lamas-Toranzo et al. 2019). To that aim, specimens were stored and digested as described for E14 fragments but employing a reduced amount (8 µL) of Arcturus Picopure DNA extraction solution. A first PCR was performed to amplify the sequence containing the CRISPR target site, adding Illumina adaptors using the primers detailed in Table 1 and adding 3 µL of lysate in a 25 µL PCR reaction (GoTaq Flexi, Promega). PCR conditions were as follows: 96°C for 2 min; ×32 (96°C for 20 s, 60°C for 30 s, 72°C for 30 s); 72°C for 5 min; hold at 8°C. The PCR product was purified using AMPure XP beads (Beckman CoulterTM) following the manufacturer´s recommendations. A second 50 µL PCR was performed with Nextera XT Index Kit v2 primers (Illumina) to add barcodes identifying each specimen, using 5 µL of each purified PCR product as a template. PCR conditions were as follows: 95°C for 3 min; ×8 (95°C for 30 s, 55°C for 30 s, 72°C for 30 s); 72°C for 5 min; hold at 8°C. The PCR products from different embryos were purified with AMPure XP beads, pooled into a 4 nM library, and sequenced at miSeq (Illumina). Reads were aligned with the WT sequence using the BWA mem aligner (v.0.7.17, (Li and Durbin 2009)), sorted and indexed with a pipeline of different tools from the SAM tools package (v.1.16.1 (Li et al. 2009)) and variants were called with freebayes(Garrison & Marth 2012). VCF files were processed with an in-house script to select only potential indels within the CRISPR probe editing region and passing the quality check filter. Results were confirmed visually by checking each VCF file with the Integrative Genomics Viewer (Thorvaldsdottir et al. 2013). Following genotyping, based on the analysis of >1000 reads of the target region/embryo, embryos were classified as wild-type (WT, containing no mutated alleles, i.e. all embryos in the C group), in-frame (IF, edited embryos containing at least one non-frame disrupting indel), and knock-out (KO, containing only alleles formed by indels non-multiple of three, i.e. frame-disrupting indels).
Telomere length analysis
Relative telomere length was analyzed in D8 (9 embryos/genotype) and D12 (9 embryos/genotype) in vitro produced embryos and in all in vivo conceptuses obtained (6 non-carrier (NC), 9 SC, and 2 DC) by qPCR following similar protocols to those described in (Bermejo-Alvarez et al. 2008; de Frutos et al. 2016), which involve the amplification of both a telomeric sequence and another chromosomal sequence, the latter serving to normalize the number of telomere repeats to the amount of total DNA present in the sample. Telomere sequences were amplified using specific primers designed by (Callicott & Womack 2006) and the multicopy sequence Sat216 (Manna et al. 2003) was used to normalize the DNA amount present in the sample. Prior to the analysis, primers (shown in Table 1) were tested to display qPCR efficiencies above 0.9, and qPCR was performed by adding 2 µL of Picopure® lysate of each sample (the same employed for embryo genotyping) to the PCR mix (GoTaq qPCR Master Mix, Promega) containing specific primers. Reactions were carried out in a 20 µL volume in a MIC thermocycler (Biomolecular Systems). Fluorescence was acquired in each cycle to determine the threshold cycle. According to the comparative CT method, the ΔCT value was determined by subtracting the endogenous control Sat216 CT value of each sample from the CT value for the telomeric sequence. ΔΔCT was calculated using the highest CT group value (i.e. the group with shorter telomeres) as an arbitrary constant to be subtracted from all other sample values. Fold changes in the relative gene expression of the target were determined using the formula 2-ΔΔCT.
Statistical analysis
Data were analyzed using GraphPad Prism (GraphPad Software) and SigmaStat (Systat Software, San Jose, CA, USA) packages. The chi-square test was used to analyze the differences in complete hypoblast migration, epiblast survival, and ED-like formation rates between groups. Differences in blastocyst rates between groups C and C+G were analyzed by t-test using the blastocyst rate of each experimental replicate (i.e. % of zygotes reaching the blastocyst stage for each group in each replicate) as input data. Differences in D7 to D12 embryo survival (input data being similar to those for blastocyst rate analysis), embryo diameter, and cell numbers between different genotypes (3: WT, IF, and KO) were analyzed by one-way ANOVA. When the normality test failed, statistical differences were analyzed by non-parametric t-test (Mann–Whitney) or one-way ANOVA (Kruskal–Wallis test).
Results
HH3 DC conceptuses fail to develop to E14
A total of 17 structures were recovered at E14 from 4 superovulated HH3 carrier cows inseminated with a carrier bull. Genotyping revealed that 2/17 were DC (Table 2), which did not deviate significantly (P > 0.05) from the expected 1/4 Mendelian proportion. Nevertheless, HH3 DC structures showed severe developmental defects. In contrast to their NC (WT) and SC counterparts, which were tubular or filamentous, DC structures remained spherical and were significantly smaller (<0.5 mm) than their NC and SC counterparts, evidencing a severe defect in the proliferation of extra-embryonic membranes (Fig. 1B, Table 3). Immunohistochemistry detected embryonic discs formed by SOX2+ epiblast cells in all 6 NC and 9 SC conceptuses analyzed, but no epiblast cells (the lineage from which the embryo proper derives) could be detected in the 2 DC structures. The differentiation of the hypoblast (an extra-embryonic lineage derived from the inner cell mass) was not affected in HH3 DC structures, as complete hypoblast migration was observed in all structures analyzed irrespective of their genotype.
Number of non-carrier (NC), single-carrier (SC), and double-carrier (DC) conceptuses obtained from 4 crosses between HH3 SC individuals. Mendelian proportion was observed (chi-square test, P > 0.05).
| Cow 1 | Cow 2 | Cow 3 | Cow 4 | Total | |
|---|---|---|---|---|---|
| Conceptuses recovered | 7 | 3 | 3 | 4 | 17 |
| NC conceptuses | 1 | 1 | 1 | 3 | 6 (35.3%) |
| SC conceptuses | 5 | 1 | 2 | 1 | 9 (52.9%) |
| DC conceptuses | 1 | 1 | 0 | 0 | 2 (11.8%) |
Conceptus elongation and lineage development in non-carrier (NC), single-carrier (SC), and double-carrier (DC) conceptuses. Different letters in the same column indicate statistically significant differences (ANOVA and chi-square test, P < 0.05).
| NC | HH3 SC | HH3 DC | |
|---|---|---|---|
| Conceptus length (mm; mean ± s.e.m.) | 14.1 ± 4.1a | 5.6 ± 2.6ab | 0.4 ± 0.0b |
| Complete hypoblast migration | 6/6 | 9/9 | 2/2 |
| Embryonic disc formation | 6/6 | 9/9 | 0/2 |
SMC2 KO embryos show reduced cell proliferation at D8 and fail to develop to D12 in vitro
To determine when the developmental defects of HH3 DC arise, SMC2 KO embryos were generated in vitro. To that aim, a group of oocytes was microinjected with Cas9 mRNA and sgRNA targeting the region of the SMC2 gene affected by the HH3 mutation (group C+G, partially composed of SMC2 KO embryos) and another with Cas9 mRNA (group C, an injection control only composed of WT embryos). Developmental rates (cleavage at 48 hpi and blastocyst rate at D8) were similar between C+G and C groups, suggesting that SMC2 disruption did not impair embryo development to the blastocyst stage (Table 4).
Developmental rates in C and C+G groups up to the blastocyst stage. The number of replicates and microinjected oocytes in all in vitro experiments, as well as cleavage and blastocyst rates in control (C) and experimental (C+G) groups, are presented (t-test, P > 0.05).
| C group | C+G group | |
|---|---|---|
| n | 4 | 4 |
| Microinjected oocytes | 192 | 304 |
| Cleavage rate | 161/192 | 240/304 |
| Mean ± s.e.m. | 83.4 ± 1.7 | 78.9 ± 0.8 |
| Blastocyst rate | 56/192 | 83/304 |
| Mean ± s.e.m. | 27.0 ± 4.5 | 26.6 ± 3.4 |
Genotyping of 38 blastocysts from C+G group revealed the presence of 9 KO embryos (which harbor only KO alleles composed of frame-disrupting indels) and 29 edited IF embryos (containing at least one IF allele), resulting in a 100% edition efficiency and ~24% KO generation efficiency, comparable to previous reports (Perez-Gomez et al. 2024a, b ). SMC2 KO blastocysts were formed by a significantly lower number of total, trophectoderm (CDX2+), and inner cell mass (SOX2+) cells compared to their WT counterparts (Fig. 2A and B), evidencing that SMC2 ablation impaired cell proliferation during early embryo development.
Development of cell lineages in D8 blastocysts. A) Representative pictures of WT, edited in-frame (IF), and SCM2 KO blastocysts after immunohistochemistry for SOX2 (ICM) and CDX2 (TE); nuclei counterstained with DAPI. Scale bar: 100 µm. B) Scatter plots of DAPI+, SOX2+, and CDX2+ cell numbers in WT, IF and SCM2 KO blastocysts. Different letters indicate statistically significant differences between groups (mean ± s.e.m.; Kruskal–Wallis test, P < 0.05). C) Representative pictures of D12 structures in C and C+G groups. Dead structures (KO embryos) showing a collapsed blastocoel are indicated with arrows. Scale bar: 500 µm.
Citation: Reproduction 168, 5; 10.1530/REP-24-0211
To evaluate the developmental potential of SMC2 KO embryos beyond the D8 blastocyst stage, a post-hatching in vitro culture system was employed to assess embryo development up to D12 (Ramos-Ibeas et al. 2020). To determine embryo survival rates for each genotype, both alive and dead structures – the latter identified as collapsed structures unable to maintain their blastocoel (Fig. 2C) – were genotyped. Genotyping revealed that none of the 9 D7 SMC2 KO blastocysts were able to survive to D12, whereas most (14/19) WT embryos developed to D12 (Table 5).
Survival rates from D7 to D12 of wild type (WT), edited in-frame (IF), and knock-out (KO) embryos. Number of D12 surviving embryos following post-hatching in vitro culture. Different letters in the same column indicate statistically significant differences (chi-square test, P < 0.05).
| Group/genotype | n | Survival rate (%) |
|---|---|---|
| C | ||
| WT | 2 | 14/19 (73.7)a |
| C+G | 2 | |
| IF | 15/32 (46.9)a | |
| KO | 0/9 (0)b |
Relative telomere length was not altered in embryos lacking condensins
Relative telomere length was similar in SMC2 KO D8 blastocysts compared to IF or WT counterparts (Fig. 3A). No differences were observed either in relative telomere length between SMC2 KO, IF, or WT D12 structures and between non-carrier, single-carrier, or double-carrier E14 conceptuses for HH3 haplotype (Fig. 3B and C).
Relative telomere length in bovine embryos lacking condensins I and II. A) Relative telomere length in WT, IF, or SMC2 KO D8 blastocysts. B) Relative telomere length in WT, IF, or SMC2 KO D12 structures. C) Relative telomere length in NC, SC, or DC E14 conceptuses for HH3 allele. No significant differences were observed between groups (mean ± s.e.m.; Kruskal–Wallis test, P > 0.05).
Citation: Reproduction 168, 5; 10.1530/REP-24-0211
Discussion
Condensins I and II are large protein complexes involved in processes requiring large-scale rearrangements of chromatin structure, including mitosis (reviewed by (Hoencamp & Rowland 2023)). Both condensins share the SMC2–SMC4 heterodimer, and therefore the ablation of any of these proteins prevents the formation of both complexes (Hirano & Mitchison 1994). Although substantial experimentation on the role of condensins has been conducted in cell cultures (e.g. Hirano & Mitchison 1994; Ono et al. 2003; 2004), the developmental ability of mammalian embryos lacking condensins has not been investigated, as the only report for Smc2 ablation in mice was not focused on embryo development but on neural stem cells (Nishide & Hirano 2014), and no data on Smc4 ablation in any mammalian embryo is publicly available. Our results show that the developmental effects of SMC2 ablation in bovine embryos are noticeable before blastocyst hatching, as reduced cell proliferation was observed in KO embryos by D8, highlighting the involvement of condensins I and II in blastomere mitosis. However, SMC2 KO embryos were able to undergo first lineage differentiation and form a functional trophectoderm able to generate a blastocoel by D8, although embryo development was arrested soon after blastocyst hatching. This observation coincides with the phenotype of naturally occurring HH3 DC embryos, which were unable to undergo elongation and had lost the lineage that would eventually form the fetus (the epiblast) before gastrulation. Although the number of HH3 DC embryos analyzed is limited due to the inherent difficulties of obtaining embryos from carrier animals under the milk production cycle, the clear developmental arrest observed at earlier stages (D12 roughly equivalent to E10 (Ramos-Ibeas et al. 2020)) confirms the early developmental arrest of embryos lacking condensins.
The combination of CRISPR technology and conventional (D0–D8) and advanced (D7–D12) in vitro embryo culture systems (Ramos-Ibeas et al. 2023) constitutes a powerful tool to test the developmental effects of any mutation, surpassing some of the limitations inherent to experimentation in large animals. However, both technologies have limitations. In the case of conventional CRISPR/Cas9 technology, KO generation rates are often below 40% despite the significantly higher edition rates (100% for the gdRNA used herein) due to the frequent presence of in-frame alleles formed by indels multiples of three (Lamas-Toranzo et al. 2019). The effect of in-frame indels on protein functionality is largely unpredictable, and therefore they cannot be deemed KO alleles, which necessitates careful genotyping techniques able to identify all the alleles harbored by an edited embryo. Cytosine base editors (Komor et al. 2016) constitute a plausible alternative to the conventional CRISPR/Cas9 system, as they can introduce a stop codon with very high efficiency, and the substitution of single bases instead of their deletion or insertion greatly facilitates greatly genotyping (Perez-Gomez et al. 2024b ). Regarding the post-hatching in vitro culture system, it allows the assessment of hypoblast differentiation and migration (i.e. yolk sac formation), the initial growth of extra-embryonic membranes, and the formation of an early embryonic disc. Unfortunately, critical landmarks of embryo development beyond ~E10, including embryonic disc growth, complete gastrulation, and massive proliferation of extra-embryonic membranes, cannot be achieved for cattle embryos under the currently available systems, although significant advances in epiblast development have been achieved in other ungulates (Ramos-Ibeas et al. 2022). This has not been a limitation for this study, as the developmental effect was observed before ~E10, but it draws a clear frontier on the developmental processes that can be studied in cattle embryos under a fully in vitro system.
The accurate identification of the timing of developmental arrest of HH3 DC embryos is economically relevant for reproductive management in dairy farms, where the inadvertent cross between heterozygous individuals (single-carriers, SC) results in a ~25% probability of generating an unviable DC embryo. Unfortunately, the carrier status of most heifers worldwide is still unknown and carrier bulls are still in use, resulting in a significant number of crosses between carrier individuals. The economic loss associated with embryonic or fetal death varies greatly depending on when DC embryos arrest their development. Pregnancy losses occurring beyond maternal recognition of pregnancy delay luteolysis, increasing both the non-productive periods (open days) and the risk of uterine pathologies associated with abortions if the DC embryo achieves implantation (Wiltbank et al. 2016). Fortunately, HH3 DC embryos arrest their development prior to maternal recognition of pregnancy, which is triggered by the secretion of interferon Tau (IFNT) from the conceptus (Helmer et al. 1989; Imakawa et al. 1987). HH3 DC conceptuses did not reach the minimum 5 mm size limit required to produce enough IFNT to prevent luteolysis (Mann & Lamming 2001). In this perspective, the embryonic losses associated with the HH3 haplotype are roughly equivalent to non-fertilizing insemination, as – in the absence of signals preventing luteolysis – the estrous cycle will resume timely, causing a minimal increase in open days.
Beyond the interest in cattle reproductive management, these results prove that condensins are essential to sustain mitotic divisions during early mammalian embryo development, although KO embryos were able to undergo ~6 cell divisions in 8 days (~50 cells). Given the essential role of condensins during mitosis, KO embryos (unable to produce SMC2 de novo) may have been able to undergo several cell divisions due to the retention of oocyte-stored SMC2 protein. At the early blastocyst stage, both lineages (ICM and TE) showed reduced proliferation, but only TE cells were detected at later stages. A plausible explanation is that the aneuploidy induced by condensin ablation could be better sustained by TE cells than epiblast cells. This hypothesis is supported by previous findings in human embryos that observed that aneuploid cells are specifically excluded from ICM-derivatives at post-hatching stages (Starostik et al. 2020) and that aneuploid stem cells can only form TE cells in human gastruloid models (Yang et al. 2021). As DC or KO embryos arrest their development due to failures in chromosome assembly and segregation during mitosis – well documented in cells lacking condensins (Hirano 2016) – we explored if those failures were associated with changes in telomere length, a parameter that has been associated with genome stability in cell lines (Murnane 2010; Zhao et al. 2023) and chromosome abnormalities in human embryos (Mania et al. 2014; Treff et al. 2011). We found no significant differences in telomere length between embryos lacking condensins (KO or DC) and WT embryos, which suggests that telomere shortening may be a cause (not a mere consequence) of the chromosomal abnormalities observed in human embryos displaying short telomeres (Mania et al. 2014; Treff et al. 2011).
In conclusion, condensins I and II are required for blastomere mitosis during early development. Bovine embryos lacking SMC2 – a core component of condensins I and II – are able to develop to the blastocyst stage, but they show reduced cell proliferation and arrest their development shortly after blastocyst hatching, failing to elongate and trigger maternal recognition of pregnancy.
Declaration of interest
The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the study reported.
Funding
This work was supported by the projects StG-757886-ELONGAN from the European Research Council and PID2020-11750RB-I00 and ECQ2018-005184-P from the Spanish Ministry of Science and Innovation to PBA.
Author contribution statement
APG, IFB, BGC, and JGH conducted in vitro embryo production experiments. APG, IFB, and BGC performed embryo genotyping and IHC analyses. APG and ILT conducted oocyte microinjection, and LGB provided in silico analyses. IFB conducted relative telomere length analysis. PRI and PBA supervised and designed experiments and managed funds. APG and PBA wrote the manuscript, which was revised by all authors.
Acknowledgements
The authors want to acknowledge Eugenio Liébana (Embriogen) for conceptus recovery, ABEREKIN and CONAFE for the identification of HH3 carrier individuals, and the slaughterhouse ‘Madrid Norte’ from gently providing bovine ovaries to conduct the experiments.
References
Bazer FW, Spencer TE, Johnson GA, Burghardt RC & & Wu G 2009 Comparative aspects of implantation. Reproduction 138 195–209. (https://doi.org/10.1530/REP-09-0158)
Bermejo-Alvarez P, Rizos D, Rath D, Lonergan P & & Gutierrez-Adan A 2008 Epigenetic differences between male and female bovine blastocysts produced in vitro. Physiological Genomics 32 264–272. (https://doi.org/10.1152/physiolgenomics.00234.2007)
Bermejo-Alvarez P, Roberts RM & & Rosenfeld CS 2012 Effect of glucose concentration during in vitro culture of mouse embryos on development to blastocyst, success of embryo transfer, and litter sex ratio. Molecular Reproduction and Development 79 329–336. (https://doi.org/10.1002/mrd.22028)
Bermejo-Alvarez P, Ramos-Ibeas P, Park KE, Powell AP, Vansandt L, Derek B, Ramirez MA, Gutierrez-Adan A & & Telugu BP 2015 Tet-mediated imprinting erasure in h19 locus following reprogramming of spermatogonial stem cells to induced pluripotent stem cells. Scientific Reports 5 13691. (https://doi.org/10.1038/srep13691)
Callicott RJ & & Womack JE 2006 Real-time pcr assay for measurement of mouse telomeres. Comparative Medicine 56 17–22.
Concordet JP & & Haeussler M 2018 Crispor: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Research 46 W242–W245. (https://doi.org/10.1093/nar/gky354)
Curran S, Pierson RA & & Ginther OJ 1986 Ultrasonographic appearance of the bovine conceptus from days 20 through 60. Journal of the American Veterinary Medical Association 189 1295–1302.
Daetwyler HD, Capitan A, Pausch H, Stothard P, van Binsbergen R, Brondum RF, Liao X, Djari A, Rodriguez SC & Grohs C et al.2014 Whole-genome sequencing of 234 bulls facilitates mapping of monogenic and complex traits in cattle. Nature Genetics 46 858–865. (https://doi.org/10.1038/ng.3034)
de Frutos C, Lopez-Cardona AP, Fonseca Balvis N, Laguna-Barraza R, Rizos D, Gutierrez-Adan A & & Bermejo-Alvarez P 2016 Spermatozoa telomeres determine telomere length in early embryos and offspring. Reproduction 151 1–7. (https://doi.org/10.1530/REP-15-0375)
Forde N, Carter F, Spencer TE, Bazer FW, Sandra O, Mansouri-Attia N, Okumu LA, McGettigan PA, Mehta JP & McBride R et al.2011 Conceptus-induced changes in the endometrial transcriptome: how soon does the cow know she is pregnant? Biology of Reproduction 85 144–156. (https://doi.org/10.1095/biolreprod.110.090019)
Garrison E & & Marth G 2012. Haplotype-Based Variant Detection from Short-Read Sequencing. (https://doi.org/10.1095/biolreprod.110.090019).
Helmer SD, Hansen PJ, Thatcher WW, Johnson JW & & Bazer FW 1989 Intrauterine infusion of highly enriched bovine trophoblast protein-1 complex exerts an antiluteolytic effect to extend corpus luteum lifespan in cyclic cattle. Journal of Reproduction and Fertility 87 89–101. (https://doi.org/10.1530/jrf.0.0870089)
Hirano T 2016 Condensin-based chromosome organization from bacteria to vertebrates. Cell 164 847–857. (https://doi.org/10.1016/j.cell.2016.01.033)
Hirano T & & Mitchison TJ 1994 A heterodimeric coiled-coil protein required for mitotic chromosome condensation in vitro. Cell 79 449–458. (https://doi.org/10.1016/0092-8674(9490254-2)
Hoencamp C & & Rowland BD 2023 Genome control by smc complexes. Nature Reviews. Molecular Cell Biology 24 633–650. (https://doi.org/10.1038/s41580-023-00609-8)
Imakawa K, Anthony RV, Kazemi M, Marotti KR, Polites HG & & Roberts RM 1987 Interferon-like sequence of ovine trophoblast protein secreted by embryonic trophectoderm. Nature 330 377–379. (https://doi.org/10.1038/330377a0)
Komor AC, Kim YB, Packer MS, Zuris JA & & Liu DR 2016 Programmable editing of a target base in genomic DNA without double-strand cleavage. Nature 533 420–424. (https://doi.org/10.1038/nature17946)
Krog CH, Agerholm JS & & Nielsen SS 2018 Fetal age assessment for holstein cattle. PLoS One 13 e0207682. (https://doi.org/10.1371/journal.pone.0207682)
Lamas-Toranzo I, Galiano-Cogolludo B, Cornudella-Ardiaca F, Cobos-Figueroa J, Ousinde O & & Bermejo-Alvarez P 2019 Strategies to reduce genetic mosaicism following CRISPR-mediated genome edition in bovine embryos. Scientific Reports 9 14900. (https://doi.org/10.1038/s41598-019-51366-8)
Li H & & Durbin R 2009 Fast and accurate short read alignment with burrows-wheeler transform. Bioinformatics 25 1754–1760. (https://doi.org/10.1093/bioinformatics/btp324)
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R & 1000 Genome Project Data Processing Subgroup 2009 The Sequence Alignment/Map format and SAMtools. Bioinformatics 25 2078–2079. (https://doi.org/10.1093/bioinformatics/btp352)
Maddox-Hyttel P, Alexopoulos NI, Vajta G, Lewis I, Rogers P, Cann L, Callesen H, Tveden-Nyborg P & & Trounson A 2003 Immunohistochemical and ultrastructural characterization of the initial post-hatching development of bovine embryos. Reproduction 125 607–623. (https://doi.org/10.1530/rep.0.1250607)
Mania A, Mantzouratou A, Delhanty JD, Baio G, Serhal P & & Sengupta SB 2014 Telomere length in human blastocysts. Reproductive Biomedicine Online 28 624–637. (https://doi.org/10.1016/j.rbmo.2013.12.010)
Mann GE & & Lamming GE 2001 Relationship between maternal endocrine environment, early embryo development and inhibition of the luteolytic mechanism in cows. Reproduction 121 175–180. (https://doi.org/10.1530/rep.0.1210175)
Manna L, Neglia G, Marino M, Gasparrini B, Di Palo R & & Zicarelli L 2003 Sex determination of buffalo embryos (Bubalus bubalis) by polymerase chain reaction. Zygote 11 17–22. (https://doi.org/10.1017/s0967199403001035)
McClure MC, Bickhart D, Null D, Vanraden P, Xu L, Wiggans G, Liu G, Schroeder S, Glasscock J & Armstrong J et al.2014 Bovine exome sequence analysis and targeted snp genotyping of recessive fertility defects bh1, hh2, and hh3 reveal a putative causative mutation in smc2 for hh3. PLoS One 9 e92769. (https://doi.org/10.1371/journal.pone.0092769)
Murnane JP 2010 Telomere loss as a mechanism for chromosome instability in human cancer. Cancer Research 70 4255–4259. (https://doi.org/10.1158/0008-5472.CAN-09-4357)
Nishide K & & Hirano T 2014 Overlapping and non-overlapping functions of condensins I and II in neural stem cell divisions. PLoS Genetics 10 e1004847. (https://doi.org/10.1371/journal.pgen.1004847)
Northey DL & & French LR 1980 Effect of embryo removal and intrauterine infusion of embryonic homogenates on the lifespan of the bovine corpus luteum. Journal of Animal Science 50 298–302. (https://doi.org/10.2527/jas1980.502298x)
Ono T, Losada A, Hirano M, Myers MP, Neuwald AF & & Hirano T 2003 Differential contributions of condensin I and condensin ii to mitotic chromosome architecture in vertebrate cells. Cell 115 109–121. (https://doi.org/10.1016/s0092-8674(0300724-4)
Ono T, Fang Y, Spector DL & & Hirano T 2004 Spatial and temporal regulation of condensins I and II in mitotic chromosome assembly in human cells. Molecular Biology of the Cell 15 3296–3308. (https://doi.org/10.1091/mbc.e04-03-0242)
Perez-Gomez A, Gonzalez-Brusi L, Bermejo-Alvarez P & & Ramos-Ibeas P 2021 Lineage differentiation markers as a proxy for embryo viability in farm ungulates. Frontiers in Veterinary Science 8 680539. (https://doi.org/10.3389/fvets.2021.680539)
Perez-Gomez A, Hamze JG, Flores-Borobia I, Galiano-Cogolludo B, Lamas-Toranzo I, Gonzalez-Brusi L, Ramos-Ibeas P & & Bermejo-Alvarez P 2024a HH5 double-carrier embryos fail to progress through early conceptus elongation. Journal of Dairy Science 107 6371–6382. (https://doi.org/10.3168/jds.2023-24482)
Perez-Gomez A, González-Brusi L, Flores-Borobia I, Martínez de Los Reyes N, Toledano A, López-Sebastián A, Santiago-Moreno J, Ramos-Ibeas P & & Bermejo-Álvarez P 2024b PPARG is dispensable for bovine embryo development up to tubular stages. Biology of Reproduction. (https://doi.org/10.1093/biolre/ioae083)
Ramos-Ibeas P, Lamas-Toranzo I, Martinez-Moro Á, de Frutos C, Quiroga AC, Zurita E & & Bermejo-Alvarez P 2020 Embryonic disc formation following post-hatching bovine embryo development in vitro. Reproduction 160 579–589. (https://doi.org/10.1530/REP-20-0243)
Ramos-Ibeas P, González-Brusi L, Used MT, Cocero MJ, Marigorta P, Alberio R & & Bermejo-Álvarez P 2022 In vitro culture of ovine embryos up to early gastrulating stages. Development 149 dev199743. (https://doi.org/10.1242/dev.199743)
Ramos-Ibeas P, Perez-Gomez A, Gonzalez-Brusi L, Quiroga AC & & Bermejo-Alvarez P 2023 Pre-hatching exposure to n2b27 medium improves post-hatching development of bovine embryos in vitro. Theriogenology 205 73–78. (https://doi.org/10.1016/j.theriogenology.2023.04.018)
Starostik MR, Sosina OA & & McCoy RC 2020 Single-cell analysis of human embryos reveals diverse patterns of aneuploidy and mosaicism. Genome Research 30 814–825. (https://doi.org/10.1101/gr.262774.120)
Stray JE, Crisona NJ, Belotserkovskii BP, Lindsley JE & & Cozzarelli NR 2005 The saccharomyces cerevisiae smc2/4 condensin compacts dna into (+) chiral structures without net supercoiling. Journal of Biological Chemistry 280 34723–34734. (https://doi.org/10.1074/jbc.M506589200)
Theiler K 1989. The House Mouse Atlas of Embryonic Development. Ed Springer Verlag.
Thorvaldsdottir H, Robinson JT & & Mesirov JP 2013 Integrative genomics viewer (igv): high-performance genomics data visualization and exploration. Briefings in Bioinformatics 14 178–192. (https://doi.org/10.1093/bib/bbs017)
Treff NR, Su J, Taylor D & & Scott RT 2011 Telomere dna deficiency is associated with development of human embryonic aneuploidy. PLoS Genetics 7 e1002161. (https://doi.org/10.1371/journal.pgen.1002161)
van Leeuwen J, Berg DK & & Pfeffer PL 2015 Morphological and gene expression changes in cattle embryos from hatched blastocyst to early gastrulation stages after transfer of in vitro produced embryos. PLoS One 10 e0129787. (https://doi.org/10.1371/journal.pone.0129787)
VanRaden PM, Olson KM, Null DJ & & Hutchison JL 2011 Harmful recessive effects on fertility detected by absence of homozygous haplotypes. Journal of Dairy Science 94 6153–6161. (https://doi.org/10.3168/jds.2011-4624)
Wiltbank MC, Baez GM, Garcia-Guerra A, Toledo MZ, Monteiro PL, Melo LF, Ochoa JC, Santos JE & & Sartori R 2016 Pivotal periods for pregnancy loss during the first trimester of gestation in lactating dairy cows. Theriogenology 86 239–253. (https://doi.org/10.1016/j.theriogenology.2016.04.037)
Yang M, Rito T, Metzger J, Naftaly J, Soman R, Hu J, Albertini DF, Barad DH, Brinvanlou AH & & Gleicher N 2021 Depletion of aneuploid cells in human embryos and gastruloids. Nature Cell Biology 23 314–321. (https://doi.org/10.1038/s41556-021-00660-7)
Zhao N, Yin G, Liu C, Zhang W, Shen Y, Wang D, Lin Z, Yang J, Mao J & Guo R et al.2023 Critically short telomeres derepress retrotransposons to promote genome instability in embryonic stem cells. Cell Discovery 9 45. (https://doi.org/10.1038/s41421-023-00538-y)
